IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Cell research 2020 imex curation Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus jlou@ibp.ac.cn,jackweichen@zju.edu.cn Only protein-protein interactions imex curation in vitro In vitro electron microscopy electron microscopy Electron crystallography Electron cryomicroscopy Electron crystallography Electron cryomicroscopy predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Accepted 2021-JUN-13 AT 14:52 BST AT 14:52 BST by SIMONA Cell research 2020 imex curation Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Cell research 2020 imex curation Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus jlou@ibp.ac.cn,jackweichen@zju.edu.cn Only protein-protein interactions imex curation in vitro In vitro fluorescence imaging fluorescence microscopy fluorescence imaging predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Accepted 2021-JUN-13 AT 14:52 BST AT 14:52 BST by SIMONA Cell research 2020 imex curation Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Cell research 2020 imex curation Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus jlou@ibp.ac.cn,jackweichen@zju.edu.cn Only protein-protein interactions imex curation in vitro In vitro dls dynamic light scattering dls predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins jlou@ibp.ac.cn,jackweichen@zju.edu.cn Accepted 2021-JUN-13 AT 14:52 BST AT 14:52 BST by SIMONA Cell research 2020 imex curation Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Liquid-liquid phase separation by SARS-CoV-2 nucleocapsid protein and RNA. Cell research 2020 imex curation Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus jlou@ibp.ac.cn,jackweichen@zju.edu.cn Only protein-protein interactions imex curation in vitro In vitro light microscopy light microscopy predetermined predetermined participant predetermined Chen H., Cui Y., Han X., Hu W., Sun M., Zhang Y., Wang PH., Song G., Chen W., Lou J. Virus - Publications including interactions involving viral proteins I have not added Supp. figure 4E as I have no idea what mols. are shown in the image.(at time=0 there should be no H20 -orange- signal?) Differential interference contrast microscopy jlou@ibp.ac.cn,jackweichen@zju.edu.cn Accepted 2021-JUN-13 AT 14:52 BST AT 14:52 BST by SIMONA Cell research 2020 imex curation n1541 rna ribonucleic acid RNA rna in vitro In vitro GGGGAAUUGUGAGCGGAUAACAAUUCCCCUCUAGAAAUAAUUUUGUUUAACUUUAAGAAGGAGAUAUACCAUGGGCAGCAGCCAUCAUCAUCAUCAUCACCACCACCACCAUAGCAGCGGCCUGGUGCCGCGCGGCAGCGCUAGCAUGUCUGAUAAUGGACCCCAAAAUCAGCGAAAUGCACCCCGCAUUACGUUUGGUGGACCCUCAGAUUCAACUGGCAGUAACCAGAAUGGAGAACGCAGUGGGGCGCGAUCAAAACAACGUCGGCCCCAAGGUUUACCCAAUAAUACUGCGUCUUGGUUCACCGCUCUCACUCAACAUGGCAAGGAAGACCUUAAAUUCCCUCGAGGACAAGGCGUUCCAAUUAACACCAAUAGCAGUCCAGAUGACCAAAUUGGCUACUACCGAAGAGCUACCAGACGAAUUCGUGGUGGUGACGGUAAAAUGAAAGAUCUCAGUCCAAGAUGGUAUUUCUACUACCUAGGAACUGGGCCAGAAGCUGGACUUCCCUAUGGUGCUAACAAAGACGGCAUCAUAUGGGUUGCAACUGAGGGAGCCUUGAAUACACCAAAAGAUCACAUUGGCACCCGCAAUCCUGCUAACAAUGCUGCAAUCGUGCUACAACUUCCUCAAGGAACAACAUUGCCAAAAGGCUUCUACGCAGAAGGGAGCAGAGGCGGCAGUCAAGCCUCUUCUCGUUCCUCAUCACGUAGUCGCAACAGUUCAAGAAAUUCAACUCCAGGCAGCAGUAGGGGAACUUCUCCUGCUAGAAUGGCUGGCAAUGGCGGUGAUGCUGCUCUUGCUUUGCUGCUGCUUGACAGAUUGAACCAGCUUGAGAGCAAAAUGUCUGGUAAAGGCCAACAACAACAAGGCCAAACUGUCACUAAGAAAUCUGCUGCUGAGGCUUCUAAGAAGCCUCGGCAAAAACGUACUGCCACUAAAGCAUACAAUGUAACACAAGCUUUCGGCAGACGUGGUCCAGAACAAACCCAAGGAAAUUUUGGGGACCAGGAACUAAUCAGACAAGGAACUGAUUACAAACAUUGGCCGCAAAUUGCACAAUUUGCCCCCAGCGCUUCAGCGUUCUUCGGAAUGUCGCGCAUUGGCAUGGAAGUCACACCUUCGGGAACGUGGUUGACCUACACAGGUGCCAUCAAAUUGGAUGACAAAGAUCCAAAUUUCAAAGAUCAAGUCAUUUUGCUGAAUAAGCAUAUUGACGCAUACAAAACAUUCCCACCAACAGAGCCUAAAAAGGACAAAAAGAAGAAGGCUGAUGAAACUCAAGCCUUACCGCAGAGACAGAAGAAACAGCAAACUGUGACUCUUCUUCCUGCUGCAGAUUUGGAUGAUUUCUCCAAACAAUUGCAACAAUCCAUGAGCAGUGCUGACUCAACUCAGGCCUGUUGAGGAUCCUGUGAAUUCGAGCUCCGUCGACAAGCUUGCGGCCGCACUCGAGCACCACCACCACCACCACUGAGAUCCGGCUGCUAACAAAGCCCGAAAGGAAGCUGAGUUGGCUGCUGCCACCGCUGAGCAAUAA a85 rna oligo a85 rna oligo rna ribonucleic acid RNA rna in vitro In vitro GGCGCAUAAAGAUGAGACGCGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGUUCG h20 h20 rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AGAUUCAACUGGCAGUAACC poly-u20 rna oligo poly-u20 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUU poly-u40 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA poly-u60 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU a20 rna oligo A20 rna oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UAGCUUAUCAGACUGAUGUU poly-u10 rna oligo poly-U10 RNA oligo rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) UUUUUUUUUU h20-n-1 4 7 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 12:45:58 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1B, Supp. figure 4 A/C,6 647-N and H20 formed micrometer-sized droplets rapidly within minutes, and the small droplets further fused into larger ones. divalent cations: Zn2+, Cu2+, Ni2+ h20-n-2 2 7 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:18:32 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1B-E, Supp. figure 3 B/C, 4A-D,6 divalent cations: Zn2+, Cu2+, Ni2+ LLPS (liquid–liquid phase separation) is dependent on ssRNA length. 647-N and H20 formed micrometer-sized droplets rapidly within minutes, and the small droplets further fused into larger ones. n-poly_u10 rna oligo-1 2 13 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 12:24:25 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1C -U10, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u20 rna oligo-2 2 8 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:32:16 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1C -U20, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u20 rna oligo-1 2 9 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:40:33 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1C -U40, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-poly_u40 rna oligo-1 2 11 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:14:50 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction 1C -U60, Supp. figure 5A N protein undergoes stronger LLPS (liquid–liquid phase separation) with longer RNAs; however the ability of N protein to undergo LLPS with short RNA is independent of short RNA sequence. n-n-38 3 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 2 E/F no info given in text as to what is shown here - maybe dimers (A+B) and higher order oligomers/aggregate (C)? Supp. Figure 2C, Molecular Sieving, (despite the text) only shows a monomer - M. Wt ~46 kDa;so NOT entered as an interaction. Authors do not specify if the N protein forms dimers or higher order aggregates Yes i agree. I have added a comment a20 rna oligo-n-1 2 12 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:39:49 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S3A, 4E a20 rna oligo-n-2 2 7 competitor competitor competitor neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 12 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:19:57 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 4E When H20 was injected into the phase-separated solution that had already been formed by 488-N and A20, HEX fluorescence also appeared gradually inside the original droplets. h20-n-3 2 10 competitor competitor competitor neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:34:28 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-488 alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) 7 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:10:09 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 4D The fluorescence intensity of Alexa-488 in droplets increased gradually along with the decrease of Alexa-647 fluorescence intensity. a85 rna oligo-n-1 2 6 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:15:09 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S5B a85 rna oligo-n-2 4 6 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:17:34 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S5B a85 rna oligo-n-3 2 5 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:03:01 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-657 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S5C n-n1541-1 4 5 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:10:29 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S5C a20 rna oligo-n-3 2 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 10:39:02 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:03:12 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 7A/B Zn2+ EDTA n-n-39 4 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:29:15 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:16:01 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 7A/B Zn2+ EDTA n-n1541-2 1 5 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 10:42:23 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' C-terminus alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure S7 C/D Zn2+ no idea which tag used here so left as "alexa tag". n-n-40 2 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 13:35:11 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:27:43 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-647 alexa label alexa label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. figure 7E Zn2+ h20-n-4 2 10 competitor competitor competitor neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0DTC9:p.Ala419delinsAlaCysCys mutation mutation certain certain sequence position certain certain certain sequence position certain A ACC Thu Apr 22 11:00:16 BST 2021 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala419delinsCysCys' Alexa-488 alexa 488 label alexa 488 label c-term range C-terminal range c-term range c-term range C-terminal range c-term range ctd binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 7 unspecified role unspecified role neutral component neutral component region fluorescein fluorescein label fluorescein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Supp. figure 8 Zn2+: droplet formation could be enhanced by the addition of Zn2+ for all these N protein mutants, including even the NTD domain only mutant, which failed to form phase-separated droplets with H20 in the absence of Zn2+. I have entered the CTD as a "binding region" as when it is used alone there is no signal (black/green colour) for the protein - so?