IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Thermodynamic investigation of DNA-binding affinity of wild-type and mutant transcription factor RUNX1. Thermodynamic investigation of DNA-binding affinity of wild-type and mutant transcription factor RUNX1. PloS one 2018 imex curation Wu F., Song T., Yao Y., Song Y. ysong@bcm.edu 03-Oct-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro itc isothermal titration calorimetry ITC ITC itc predetermined predetermined participant predetermined Wu F., Song T., Yao Y., Song Y. ysong@bcm.edu Accepted 2019-SEP-18 AT 08:22 BST AT 08:22 BST by LIVIAP PloS one 2018 Only protein-protein interactions imex curation imex curation q01196-1 Runt-related transcription factor 1 RUNX1 AML1 CBFA2 Acute myeloid leukemia 1 protein Core-binding factor subunit alpha-2 Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein human Homo sapiens Human MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDAGAALAGKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDTRQIQPSPPWSYDQSYQYLGSIASPSVHPATPISPGRASGMTTLSAELSSRLSTAPDLTAFSDPRQFPALPSISDPRMHYPGAFTYSPTPVTSGIGIGMSAMGSATRYHTYLPPPYPGSSQAQGGPFQASSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGSALLNPSLPNQSDVVEAEGSHSNSPTNMAPSARLEEAVWRPY 4F1F193A7CADDBAB csf1r-promoter human csf1r-promoter nucleic acid nucleic acid human Homo sapiens Human CAAACTCTGTGGTTGCCTTGC pebb_human Core-binding factor subunit beta Polyomavirus enhancer-binding protein 2 beta subunit SL3-3 enhancer factor 1 subunit beta SL3/AKV core-binding factor beta subunit CBFB protein protein human Homo sapiens Human MPRVVPDQRSKFENEEFFRKLSRECEIKYTGFRDRPHEERQARFQNACRDGRSEIAFVATGTNLSLQFFPASWQGEQRQTPSREYVDLEREAGKVYLKAPMILNGVCVIWKGWIDLQRLDGMGCLEFDEERAQQEDALAQQAFEEARRRTREFEDRDRSHREEMEVRVSQLLAVTGKKTTRP DIP protein Q13951 original sequence version: 131 DIP protein Q13951 original sequence version: 143 DIP protein Q13951 original sequence version: 142 20FB1CC05FBFE4FB csf1r_promoter-runx1-1 1 2 unspecified role unspecified role neutral component neutral component purified purified Q01196-1:p.Ser114Leu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S L Tue Jun 30 19:44:10 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser114Leu' Q01196-1:p.Arg139Gln mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain R Q Tue Jun 30 16:37:22 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg139Gln' Q01196-1:p.Lys83Glu mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain K E Tue Jun 30 18:32:00 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys83Glu' region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain Q01196-1:p.Lys83Arg mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain K R Tue Jun 30 18:47:09 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys83Arg' Q01196-1:p.His179Lys mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain H K Tue Jun 30 19:07:12 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His179Lys' Q01196-1:p.[Lys83Arg;His179Lys] mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain K R certain certain sequence position certain certain certain sequence position certain H K Tue Jun 30 17:37:26 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys83Arg;His179Lys]' ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role neutral component neutral component purified purified direct interaction direct interaction Fig 2, Fig 4, Table 1 cbfb-runx1-4 1 4 unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 2 unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain Q01196-1:p.Lys83Glu mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain K E Tue Jun 30 16:38:45 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys83Glu' Q01196-1:p.Ser114Leu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S L Tue Jun 30 18:18:11 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser114Leu' Q01196-1:p.Arg139Gln mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain R Q Tue Jun 30 17:50:46 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg139Gln' Q01196-1:p.Lys83Arg mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain K R Tue Jun 30 16:11:43 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys83Arg' Q01196-1:p.His179Lys mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain H K Tue Jun 30 20:14:08 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His179Lys' Q01196-1:p.[Lys83Arg;His179Lys] mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain K R certain certain sequence position certain certain certain sequence position certain H K Tue Jun 30 19:22:32 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys83Arg;His179Lys]' ecoli Escherichia coli (strain K12) physical association physical association Fig 2, Fig 4, Table 1