IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Human mutation 2012 imex curation Jiang YC., Wu HM., Cheng KH., Sunny Sun H. hssun@mail.ncku.edu.tw 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift antibody detection identification by antibody antibody detection Jiang YC., Wu HM., Cheng KH., Sunny Sun H. Waiting: "CHIP results from Figure 3D omitted." for discussion with Pablo. Ch-IP experiment (Fig 3d) was not captured as the primer sequences were not provided for HTR1A promoter. Also in this case we need to map a mutation - which is not possible as the promoter sequences are not available hssun@mail.ncku.edu.tw Accepted 2019-OCT-11 AT 10:37 BST AT 10:37 BST by MGT Human mutation 2012 Only protein-protein interactions imex curation imex curation Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Human mutation 2012 imex curation Jiang YC., Wu HM., Cheng KH., Sunny Sun H. hssun@mail.ncku.edu.tw 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down experimental particp experimental participant identification experimental particp Jiang YC., Wu HM., Cheng KH., Sunny Sun H. Waiting: "CHIP results from Figure 3D omitted." for discussion with Pablo. hssun@mail.ncku.edu.tw Accepted 2019-OCT-11 AT 10:37 BST AT 10:37 BST by MGT Human mutation 2012 Only protein-protein interactions imex curation imex curation Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Menstrual cycle-dependent febrile episode mediated by sequence-specific repression of poly(ADP-ribose) polymerase-1 on the transcription of the human serotonin receptor 1A gene. Human mutation 2012 imex curation Jiang YC., Wu HM., Cheng KH., Sunny Sun H. hssun@mail.ncku.edu.tw 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Jiang YC., Wu HM., Cheng KH., Sunny Sun H. Waiting: "CHIP results from Figure 3D omitted." for discussion with Pablo. hssun@mail.ncku.edu.tw Accepted 2019-OCT-11 AT 10:37 BST AT 10:37 BST by MGT Human mutation 2012 Only protein-protein interactions imex curation imex curation htr1a-promoter_probe human htr1a promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GGCAGAAGAGAGAGAAGAGAGGAGGAGAGA chr5:63962185-63962214 parp1_human Poly [ADP-ribose] polymerase 1 PARP1 ADPRT PPOL NAD(+) ADP-ribosyltransferase 1 Poly[ADP-ribose] synthase 1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein human Homo sapiens Human MAESSDKLYRVEYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGHSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVTGKGQDGIGSKAEKTLGDFAAEYAKSNRSTCKGCMEKIEKGQVRLSKKMVDPEKPQLGMIDRWYHPGCFVKNREELGFRPEYSASQLKGFSLLATEDKEALKKQLPGVKSEGKRKGDEVDGVDEVAKKKSKKEKDKDSKLEKALKAQNDLIWNIKDELKKVCSTNDLKELLIFNKQQVPSGESAILDRVADGMVFGALLPCEECSGQLVFKSDAYYCTGDVTAWTKCMVKTQTPNRKEWVTPKEFREISYLKKLKVKKQDRIFPPETSASVAATPPPSTASAPAAVNSSASADKPLSNMKILTLGKLSRNKDEVKAMIEKLGGKLTGTANKASLCISTKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQELFLAHILSPWGAEVKAEPVEVVAPRGKSGAALSKKSKGQVKEEGINKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKENRYWIFRSWGRVGTVIGSNKLEQMPSKEDAIEHFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVNPGTKSKLPKPVQDLIKMIFDVESMKKAMVEYEIDLQKMPLGKLSKRQIQAAYSILSEVQQAVSQGSSDSQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEIIRKYVKNTHATTHNAYDLEVIDIFKIEREGECQRYKPFKQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLILLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSANISLDGVDVPLGTGISSGVNDTSLLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW DIP protein P09874 original sequence version: 189 DIP protein P09874 original sequence version: 183 DIP protein P09874 original sequence version: 166 DIP protein P09874 original sequence version: 117 DIP protein P09874 original sequence version: 143 DIP protein P09874 original sequence version: 136 DIP protein P09874 original sequence version: 137 DIP protein P09874 original sequence version: 147 DIP protein P09874 original sequence version: 193 DIP protein P09874 original sequence version: 202 DIP protein P09874 original sequence version: 171 DIP protein P09874 original sequence version: 153 DIP protein P09874 original sequence version: 175 6A5FC01EB91C046B htr1a_promoter-parp1-1 1 4 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n.16delA NM_000524.3:c.-480delA mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain A . chemical synthesis Chemical synthesis (Chemical synthesis) 5:63962214-63962185 5 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells physical association physical association Figure 3c htr1a_promoter-parp1-2 2 4 unspecified role unspecified role bait bait purified purified region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n.16delA NM_000524.3:c.-480delA mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain A . chemical synthesis Chemical synthesis (Chemical synthesis) 5:63962214-63962185 (chr5:63962185-63962214) 5 weight silver stain molecular weight estimation by silver staining weight silver stain sequence tag sequence tag identification sequence tag western blot western blot Immuno blot Immuno blot experimental particp experimental participant identification experimental particp unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep human-sh_sy5y Homo sapiens SH-SY5Y cell line sh_sy5y Human neuroblastoma cells physical association physical association Figure 3a, 3b parp1-htr1a_promoter_probe-1 3 4 unspecified role unspecified role prey prey n.16delA mutation causing mutation causing an interaction mutation enabling interaction mutation causing mutation causing an interaction certain certain sequence position certain certain certain sequence position certain A . chr5:63962185-63962214 5 unspecified role unspecified role bait bait physiological level physiological level endogenous level endogenous endogenous endogenous level physical association physical association 3D ChIP assay was performed with transfected WT or Mutant HTR1A reporter construct. The Primers used are not specified and none in Table S2 cover the region in question (-just upstream from the Transcription start site) or the genomic location cannot be identified. The mutation is -480 residues from the Translation start site and -66 residues from the Transcription start site. (mutation is rs367956927 in Dbsnp) the probe sequence has been used to identify the mutation site as no primers are suitable-either too far upstream, or start within CDS beyond the mutation site or do not give any result on blatting. In the unlikely event of author reply this can be changed.