IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The transcription factor GATA-4 regulates cytochrome P4502C19 gene expression. The transcription factor GATA-4 regulates cytochrome P4502C19 gene expression. Life sciences 2010 imex curation Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se Accepted 2019-JUL-15 AT 09:00 BST AT 09:00 BST by LIVIAP Life sciences 2010 Only protein-protein interactions imex curation imex curation Interaction added with GATA-6 for fig.4b; Bait-prey roles reversed; biding region added; promoter sequences annotated The transcription factor GATA-4 regulates cytochrome P4502C19 gene expression. The transcription factor GATA-4 regulates cytochrome P4502C19 gene expression. Life sciences 2010 imex curation Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Mwinyi J., Hofmann Y., Pedersen RS., Nekvindová J., Cavaco I., Mkrtchian S., Ingelman-Sundberg M. Jessica.Mwinyi@ki.se Accepted 2019-JUL-15 AT 09:00 BST AT 09:00 BST by LIVIAP Life sciences 2010 Only protein-protein interactions imex curation imex curation Interaction added with GATA-6 for fig.4b; Bait-prey roles reversed; biding region added; promoter sequences annotated gata4_human Transcription factor GATA-4 GATA4 GATA-binding factor 4 protein protein human Homo sapiens Human MYQSLAMAANHGPPPGAYEAGGPGAFMHGAGAASSPVYVPTPRVPSSVLGLSYLQGGGAGSASGGASGGSSGGAASGAGPGTQQGSPGWSQAGADGAAYTPPPVSPRFSFPGTTGSLAAAAAAAAAREAAAYSSGGGAAGAGLAGREQYGRAGFAGSYSSPYPAYMADVGASWAAAAAASAGPFDSPVLHSLPGRANPAARHPNLDMFDDFSEGRECVNCGAMSTPLWRRDGTGHYLCNACGLYHKMNGINRPLIKPQRRLSASRRVGLSCANCQTTTTTLWRRNAEGEPVCNACGLYMKLHGVPRPLAMRKEGIQTRKRKPKNLNKSKTPAAPSGSESLPPASGASSNSSNATTSSSEEMRPIKTEPGLSSHYGHSSSVSQTFSVSAMSGHGPSIHPVLSALKLSPQGYASPVSQSPQTSSKQDSWNSLVLADSHGDIITA Defects in GATA4 are the cause of atrial septal defect type 2 (ASD2) [MIM:607941]. ASD2 is a congenital heart malformation characterized by incomplete closure of the wall between the atria resulting in blood flow from the left to the right atria. ASD2 patients show other heart abnormalities including ventricular and atrioventricular septal defects, pulmonary valve thickening or insufficiency of the cardiac valves. ASD2 is not associated with defects in the cardiac conduction system or non-cardiac abnormalities mint Transcriptional activator. Binds to the consensus sequence 5'-AGATAG-3'. Acts as a transcriptional activator of ANF in cooperation with NKX2-5 141B8CD841E12C7B gata6_human Transcription factor GATA-6 GATA6 GATA-binding factor 6 protein protein human Homo sapiens Human MALTDGGWCLPKRFGAAGADASDSRAFPAREPSTPPSPISSSSSSCSRGGERGPGGASNCGTPQLDTEAAAGPPARSLLLSSYASHPFGAPHGPSAPGVAGPGGNLSSWEDLLLFTDLDQAATASKLLWSSRGAKLSPFAPEQPEEMYQTLAALSSQGPAAYDGAPGGFVHSAAAAAAAAAAASSPVYVPTTRVGSMLPGLPYHLQGSGSGPANHAGGAGAHPGWPQASADSPPYGSGGGAAGGGAAGPGGAGSAAAHVSARFPYSPSPPMANGAAREPGGYAAAGSGGAGGVSGGGSSLAAMGGREPQYSSLSAARPLNGTYHHHHHHHHHHPSPYSPYVGAPLTPAWPAGPFETPVLHSLQSRAGAPLPVPRGPSADLLEDLSESRECVNCGSIQTPLWRRDGTGHYLCNACGLYSKMNGLSRPLIKPQKRVPSSRRLGLSCANCHTTTTTLWRRNAEGEPVCNACGLYMKLHGVPRPLAMKKEGIQTRKRKPKNINKSKTCSGNSNNSIPMTPTSTSSNSDDCSKNTSPTTQPTASGAGAPVMTGAGESTNPENSELKYSGQDGLYIGVSLASPAEVTSSVRPDSWCALALA C4D5410916543E0B gata-4_binding_region human_gata-4_binding_region nucleic acid nucleic acid human Homo sapiens Human ATTTTATTTTTATCTCTATCAGTGGGTCAA cp2cj_human_gene Cytochrome P450 2C19 CYP2C19 gene gene human Homo sapiens Human gata_4_binding_region-gata4-1 1 3 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 5 unspecified role unspecified role bait bait purified purified n.12_14delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain ATC TTT n.18_20delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain ATC TTT chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association Fig. 4a gata_4_binding_region-gata4-2 1 3 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma 5 unspecified role unspecified role bait bait purified purified n.18_20delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain ATC TTT n.12_14delinsTTT mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain ATC TTT chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association Fig. 4b cyp2c19-cyp2c19-1 2 3 unspecified role unspecified role bait bait subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Forward: 5′-TGAAACCAGAATGTACAGAGTGGG Reverse: 5′-AAGACAACCGTGAGCTTGCAC physical association physical association Fig. 5 gata_4_binding_region-gata4-3 1 4 unspecified role unspecified role prey prey subcellular prep subcellular preparation subcellular prep physiological level physiological level endogenous level endogenous endogenous endogenous level human-huh7 Homo sapiens hepatoma cell line established from a hepatocellular carcinoma huh7 Human hepatoma cell line established from a hepatocellular carcinoma 5 unspecified role unspecified role bait bait purified purified chemical synthesis Chemical synthesis (Chemical synthesis) 10:94762531-94762560 physical association physical association Fig. 4b