IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene 2010 imex curation Wu S., Huang S., Ding J., Zhao Y., Liang L., Liu T., Zhan R., He X. xhhe@shsci.org 21-Nov-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. mirna interference luciferase assay miRNA interference luciferase reporter assay miRNA interference luciferase assay tag luciferase tag visualisation by luciferase assay tag luciferase Wu S., Huang S., Ding J., Zhao Y., Liang L., Liu T., Zhan R., He X. xhhe@shsci.org Accepted 2019-OCT-10 AT 17:20 BST AT 17:20 BST by KALPANAP Oncogene 2010 imex curation hsa-mir-132-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UAACAGUCUACAGCCAUGGUCG hsa-mir-28-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AAGGAGCUCACAGUCUAUUGAG hsa-mir-572 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GUCCGCUCGGCGGUGGCCCA hsa-mir-345 5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GCUGACUCCUAGUCCAGGGCUC hsa-mir-363-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AAUUGCACGGUAUCCAUCUGUA mrna_cdkn1a cyclin dependent kinase inhibitor 1A mrna messenger rna mRNA mrna human Homo sapiens Human AGCTGAGGTGTGAGCAGCTGCCGAAGTCAGTTCCTTGTGGAGCCGGAGCTGGGCGCGGATTCGCCGAGGCACCGAGGCACTCAGAGGAGGTGAGAGAGCGGCGGCAGACAACAGGGGACCCCGGGCCGGCGGCCCAGAGCCGAGCCAAGCGTGCCCGCGTGTGTCCCTGCGTGTCCGCGAGGATGCGTGTTCGCGGGTGTGTGCTGCGTTCACAGGTGTTTCTGCGGCAGGCGCCATGTCAGAACCGGCTGGGGATGTCCGTCAGAACCCATGCGGCAGCAAGGCCTGCCGCCGCCTCTTCGGCCCAGTGGACAGCGAGCAGCTGAGCCGCGACTGTGATGCGCTAATGGCGGGCTGCATCCAGGAGGCCCGTGAGCGATGGAACTTCGACTTTGTCACCGAGACACCACTGGAGGGTGACTTCGCCTGGGAGCGTGTGCGGGGCCTTGGCCTGCCCAAGCTCTACCTTCCCACGGGGCCCCGGCGAGGCCGGGATGAGTTGGGAGGAGGCAGGCGGCCTGGCACCTCACCTGCTCTGCTGCAGGGGACAGCAGAGGAAGACCATGTGGACCTGTCACTGTCTTGTACCCTTGTGCCTCGCTCAGGGGAGCAGGCTGAAGGGTCCCCAGGTGGACCTGGAGACTCTCAGGGTCGAAAACGGCGGCAGACCAGCATGACAGATTTCTACCACTCCAAACGCCGGCTGATCTTCTCCAAGAGGAAGCCCTAATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATGAAATACTATTTAAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTGGGCCGGCTTCATGCCAGCTACTTCCTCCTCCCCACTTGTCCGCTGGGTGGTACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTTATGAAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAGAAGTAAACAGATGGCACTTTGAAGGGGCCTCACCGAGTGGGGGCATCATCAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCCTGAAGTGAGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGCTCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGAAGGTGGGGTCCTGGAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGAGCCCGTCTCAGTGTTGAGCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGAGGAGCCCCAGCTACCCTTCTTCTCCAGCTGGGCTCTGCAATTCCCCTCTGCTGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGTGGCTCTGAGGTGCCTGTCCCACCCCCACCCCCAGCTCAATGGACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAGGCAGCTCAAGCAGCGACCGCCCCCTCCTCTAGCTGTGGGGGTGAGGGTCCCATGTGGTGGCACAGGCCCCCTTGAGTGGGGTTATCTCTGTGTTAGGGGTATATGATGGGGGAGTAGATCTTTCTAGGAGGGAGACACTGGCCCCTCAAATCGTCCAGCGACCTTCCTCATCCACCCCATCCCTCCCCAGTTCATTGCACTTTGATTAGCAGCGGAACAAGGAGTCAGACATTTTAAGATGGTGGCAGTAGAGGCTATGGACAGGGCATGCCACGTGGGCTCATATGGGGCTGGGAGTAGTTGTCTTTCCTGGCACTAACGTTGAGCCCCTGGAGGCACTGAAGTGCTTAGTGTACTTGGAGTATTGGGGTCTGACCCCAAACACCTTCCAGCTCCTGTAACATACTGGCCTGGACTGTTTTCTCTCGGCTCCCCATGTGTCCTGGTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGGACCACACCCTGTACTGTTCTGTGTCTTTCACAGCTCCTCCCACAATGCTGAATATACAGCAGGTGCTCAATAAATGATTCTTAGTGACTTTACTTGTAAAAAAAAAAAAAAAAA hsa-mir-654-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UAUGUCUGCUGACCAUCACCUU hsa-mir423-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AGCUCGGUCUGAGGCCCCUCAGU hsa-mir-93-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human CAAAGUGCUGUUCGUGCAGGUAG hsa-mir-298 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AGCAGAAGCAGGGAGGUUCUCCCA hsa-mir-515-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GAGUGCCUUCUUUUGGAGCGUU hsa-mir-299-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UGGUUUACCGUCCCACAUACAU hsa-mir-125a-5p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human UCCCUGAGACCCUUUAACCUGUGA hsa-mir-657 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human GGCAGGUUCUCACCCUCUCUAGG hsa-mir-639 mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AUCGCUGCGGUUGCGAGCGCUGU hsa-mir-208a-3p mirna micro rna micro RNA micro-RNA micro-rna mirna miRNA human Homo sapiens Human AUAAGACGAGCAAAAAGCUUGU hsa_mir_298-mrna_cdkn1a-1 1 11 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.791_795delinsgaaga mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CTTCT GAAGA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_208a 3p-mrna_cdkn1a-1 1 17 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.816_820delinscagaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GTCTT CAGAA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_363 3p-mrna_cdkn1a-1 1 6 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1520_1524delinsgacgt mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CTGCA GACGT physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_657-mrna_cdkn1a-1 1 15 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1598_1602delinsatgga mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain TGCCT ATGGA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_345 5p-mrna_cdkn1a-1 1 5 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1902_1906delinscctca mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GGAGT CCTCA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_132 3p-mrna_cdkn1a-1 1 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.?-?delinsgtcag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined The sequence of the primer used to mutate the miR132 site does not exist on this RNA sequence of cdkn1a nor in other 3 I have checked 2 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_654 3p-mrna_cdkn1a-1 1 8 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1907_1911delinsgcctg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CAGAC GCCTG physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_125a 5p-mrna_cdkn1a-1 1 14 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1774_1778delinsaatcc mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain TTAGG AATCC physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_639-mrna_cdkn1a-1 1 16 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1691_1695delinscgtta mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GCAGC CGTTA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_299 5p-mrna_cdkn1a-1 1 13 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1795_1799delinscatct mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GTAGA CATCT physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_572-mrna_cdkn1a-1 1 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1754_1758delinscctca mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain TGAGT CCTCA 4 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_28_5p-mrna_cdkn1a-1 1 3 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered r.[?_?delinsgtcag;2072_2076delinstcgag] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain AGCTC TCGAG undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined r.?_?delinsgtcag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.2072_2076delinstcgag mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain AGCTC TCGAG physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir423_3p-mrna_cdkn1a-1 1 9 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.1304_1308delinscgact mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GCTGA CGACT physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization hsa_mir_93 5p-mrna_cdkn1a-1 1 10 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered r.1879_1883delinsgtgaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CACTT GTGAA r.1199_1203delinsgtgaa mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CACTT GTGAA tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.[1199_1203delinsgtgaa; 1879_1883delinsgtgaa] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain CACTT GTGAA certain certain sequence position certain certain certain sequence position certain CACTT GTGAA physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization In the sequences of supplementary table S4 authors have inverted Forward primers to mutate miR 93 seed sequence with Reverse primers hsa_mir_515_3p-mrna_cdkn1a-1 1 12 predetermined predetermined participant predetermined tag luciferase tag visualisation by luciferase assay tag luciferase regulator regulator modulator regulator neutral component neutral component engineered engineered purified purified 7 regulator target regulator target regulator target modulator target neutral component neutral component over-expressed over expressed level over-expressed living cell living cell engineered engineered tag luciferase tag luciferase tag 3' range 3' range 3' range 3' range r.953_957delinscccgt mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain GGGCA CCCGT physical association physical association Fig 1; Suppl fig 2 down-regulates quantity by destabilization