IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing. Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing. RNA (New York, N.Y.) 2011 imex curation Jamonnak N., Creamer TJ., Darby MM., Schaughency P., Wheelan SJ., Corden JL. jcorden@jhmi.edu 27-Mar-2018: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast par-clip par-clip PAR-CLIP Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation par-clip nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Jamonnak N., Creamer TJ., Darby MM., Schaughency P., Wheelan SJ., Corden JL. Yeast cells grown in the absence of glucose jcorden@jhmi.edu Accepted 2018-MAR-01 AT 10:23 GMT AT 10:23 GMT by PPORRAS RNA (New York, N.Y.) 2011 Only protein-protein interactions imex curation imex curation Exp prep added as suggested, however I think the proteins are not overexpressed. I had not added the lower signals of fig 4D. I have now added all. I have duplicated the entries of Fig 5 in a new experiment with an exp modification (cells grown in the absence of glucose). I have left the comment to clarify. Is it fine? Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing. Yeast Nrd1, Nab3, and Sen1 transcriptome-wide binding maps suggest multiple roles in post-transcriptional RNA processing. RNA (New York, N.Y.) 2011 imex curation Jamonnak N., Creamer TJ., Darby MM., Schaughency P., Wheelan SJ., Corden JL. jcorden@jhmi.edu 27-Mar-2018: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast par-clip par-clip PAR-CLIP Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation par-clip nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Jamonnak N., Creamer TJ., Darby MM., Schaughency P., Wheelan SJ., Corden JL. jcorden@jhmi.edu Accepted 2018-MAR-01 AT 10:23 GMT AT 10:23 GMT by PPORRAS RNA (New York, N.Y.) 2011 Only protein-protein interactions imex curation imex curation Exp prep added as suggested, however I think the proteins are not overexpressed. I had not added the lower signals of fig 4D. I have now added all. I have duplicated the entries of Fig 5 in a new experiment with an exp modification (cells grown in the absence of glucose). I have left the comment to clarify. Is it fine? sen1_yeast Helicase SEN1 SEN1 YLR430W L9576.1 tRNA-splicing endonuclease positive effector protein protein yeast Saccharomyces cerevisiae Baker's yeast MNSNNPDNNNSNNINNNNKDKDIAPNSDVQLATVYTKAKSYIPQIEQVYQGTNPNIQEAKLLGELLQVLAEVPKGTHLFCDPILEPISIFSLTIFSFNEEATATWLKNHFNPILSVCDKCILNFARGKCKMLQHFAIQRHVPHEHVAKFNDIVCQWRVEAVFPILRNISVNDNTGINITNEIETAMYECLCNPHMLRLNKQLKATFEAIFKFFYDTKHRLLDVTNPLSIKTFISGVIFCWCEGSKEENEWSRAFLKDLYSRNFHINLSNLTPDIIEEVYIHILFLQNPANWTEIVVSQFWSRLLPVFNLFDKDVFIEYFQVPKNVESLKKTFKFPLEPIFKMWYNHLSKSYHDKPLDFLLRGLTMFLNKFGSEFWSKIEPFTFHSILDIIFNRDSFPIKLIKIQDNPIVEHQTEVYFQLTGSVTDLLSWTLPFYHALSPSKRIQMVRKVSMAFLRIIANYPSLKSIPKACLMNSATALLRAVLTIKENERAMLYKNDEFETVLLTKTDSRALLNNPLIQDIIIRSASNPNDFYPGLGAASASVATSTMMVLAECIDFDILLLCHRTFKLYSGKPISEIPISTNVLENVTNKIDLRSFHDGPLLAKQLLVSLKNINGLLIVPSNTAVAEAHNALNQKFLLLSTRLMEKFADILPGQLSKILADEDASQGFWSCIFSSDKHLYQAATNILYNTFDVEGRLEGILAILNSNLTVNLKNINVMLQRLINCEFYEPCPRAVRVLMDVVSAFVDPISGVFANFQTLKSQNTEKEFLKFWESCWLFLDTIYKFTLKWASKYDYSELENFTKDTLDLSRSLVDSFREFSDILHDQTKNLLLNVLETFKNMLYWLRLSDEVLLESCVRLIISTSDLAHEKHVKVDDSLVEMMAKYASKAKRFSNKLTEQQASEILQKAKIFNKALTEEVATEAENYRKEKELSRLGKVIDLTDSVPASPSLSPSLSSTIASSSAESRADYLQRKALSSSITGRPRVAQPKITSFGTFQSSANAKLHRTKPVKPLSKMELARMQLLNNRVVHPPSAPAFHTKSRGLSNKNDDSSSEESDNDIESARELFAIAKAKGKGIQTVDINGKVVKRQTAAELAKQELEHMRKRLNVDMNPLYEIILQWDYTRNSEYPDDEPIGNYSDVKDFFNSPADYQKVMKPLLLLESWQGLCSSRDREDYKPFSIIVGNRTAVSDFYDVYASVAKQVIQDCGISESDLIVMAYLPDFRPDKRLSSDDFKKAQHTCLAKVRTLKNTKGGNVDVTLRIHRNHSFSKFLTLRSEIYCVKVMQMTTIEREYSTLEGLEYYDLVGQILQAKPSPPVNVDAAEIETVKKSYKLNTSQAEAIVNSVSKEGFSLIQGPPGTGKTKTILGIIGYFLSTKNASSSNVIKVPLEKNSSNTEQLLKKQKILICAPSNAAVDEICLRLKSGVYDKQGHQFKPQLVRVGRSDVVNVAIKDLTLEELVDKRIGERNYEIRTDPELERKFNNAVTKRRELRGKLDSESGNPESPMSTEDISKLQLKIRELSKIINELGRDRDEMREKNSVNYRNRDLDRRNAQAHILAVSDIICSTLSGSAHDVLATMGIKFDTVIIDEACQCTELSSIIPLRYGGKRCIMVGDPNQLPPTVLSGAASNFKYNQSLFVRMEKNSSPYLLDVQYRMHPSISKFPSSEFYQGRLKDGPGMDILNKRPWHQLEPLAPYKFFDIISGRQEQNAKTMSYTNMEEIRVAIELVDYLFRKFDNKIDFTGKIGIISPYREQMQKMRKEFARYFGGMINKSIDFNTIDGFQGQEKEIILISCVRADDTKSSVGFLKDFRRMNVALTRAKTSIWVLGHQRSLAKSKLWRDLIEDAKDRSCLAYACSGFLDPRNNRAQSILRKFNVPVPSEQEDDYKLPMEYITQGPDEVKSNKDTKKRRVVDEGEEADKAVKKKKKEKKKEKKKSKADDKKKNNKKAESPSTSSGTKKKSSIFGGMSVPSAVVPKTFPDVDSNKKAAAVVGKKKNNKHVCFSDDVSFIPRNDEPEIKVTRSLSSVLKEKQLGLKETRTISPPEISNNEDDDDEDDYTPSISDSSLMKSEANGRNNRVASHNQNFSASIYDDPQVSQAKQTQVPAAITKHRSSNSVLSGGSSRILTASDYGEPNQNGQNGANRTLSQHVGNANQYSTAPVGTGELHETLPAHPQDSYPAEAEDPYDLNPHPQPQSSAFKGPGSGPTGTRNSSRRNASSSPFIPKKRKPRS 88F0FF95B3A8BD89 88F0FF95B3A8BD89 snr13 yeast small nucleolar RNA 13 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AGGAAGUUUUUUCCUUUUUAUAUGAUGAAUAUGAGUGCAUUUGGCUCGAGUUGCUGUUUGGCUUUUGCCAAAUCAGUAACGGUGUGGAAAAACUCAAGCUACCUUUUUUUACUUUUAUCUGACC snr40 yeast small nucleolar RNA 40 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast GUAAAUGACGAGAAAAAAGCUGUGCACCAGUCUGAACAUGGAUGCCACAAGUACUCAGGUGUCCUAUGAAGCAUUAAGUAUACCCAAAUUUCUGAUC nab3_yeast Nuclear polyadenylated RNA-binding protein 3 YPL190C NAB3 HMD1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSDENHNSDVQDIPSPELSVDSNSNENELMNNSSADDGIEFDAPEEEREAEREEENEEQHELEDVNDEEEEDKEEKGEENGEVINTEEEEEEEHQQKGGNDDDDDDNEEEEEEEEDDDDDDDDDDDDEEEEEEEEEEGNDNSSVGSDSAAEDGEDEEDKKDKTKDKEVELRRETLEKEQKDVDEAIKKITREENDNTHFPTNMENVNYDLLQKQVKYIMDSNMLNLPQFQHLPQEEKMSAILAMLNSNSDTALSVPPHDSTISTTASASATSGARSNDQRKPPLSDAQRRMRFPRADLSKPITEEEHDRYAAYLHGENKITEMHNIPPKSRLFIGNLPLKNVSKEDLFRIFSPYGHIMQINIKNAFGFIQFDNPQSVRDAIECESQEMNFGKKLILEVSSSNARPQFDHGDHGTNSSSTFISSAKRPFQTESGDMYNDDNGAGYKKSRRHTVSCNIFVKRTADRTYAIEVFNRFRDGTGLETDMIFLKPRMELGKLINDAAYNGVWGVVLVNKTHNVDVQTFYKGSQGETKFDEYISISADDAVAIFNNIKNNRNNSRPTDYRAMSHQQNIYGAPPLPVPNGPAVGPPPQTNYYQGYSMPPPQQQQQQPYGNYGMPPPSHDQGYGSQPPIPMNQSYGRYQTSIPPPPPQQQIPQGYGRYQAGPPPQPPSQTPMDQQQLLSAIQNLPPNVVSNLLSMAQQQQQQPHAQQQLVGLIQSMQGQAPQQQQQQLGGYSSMNSSSPPPMSTNYNGQNISAKPSAPPMSHQPPPPQQQQQQQQQQQQQQQQPAGNNVQSLLDSLAKLQK CD6D2C7F24A44993 CD6D2C7F24A44993 snr5 yeast small nucleolar RNA 5 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AUCAUUCAAUAAACUGAUCUUCCGGAUUACCAUGCUUAAGACAUCACGCCUCCAUAUGUCUAUAUAAAGCGCAAAUGGCUGGAAGUAGACCAAUUUUUUUUGUUCCUAGCUUUUCAUUAUUGAAAUCUAAUCCAGUUUUAAUGGUUUUUCUUAAUUAAGAAAACAAAUUAUCAUUGGUUCGCUCUAGGUGUACAUAUCUUCACU snr72 yeast-1 small nucleolar RNA 72 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast GUGAUGUGAUGACAACUUCUUGAGCUAUAUAUUUUCUUGAGAACAUCAAUGAAGAAAACGUCUCAUCAAAUGAUUUGCACGUCAGUCUGAUCACAAGC snr74 yeast small nucleolar RNA 74 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UGCAGAAGAUGAAACAAAUUACUCAAAUAGACAAGCAUAUGUCUGAUCUUCAUGAUUGAAAAGAGCAAUUAGUGUCUGAUGCAAUUUA nrd1_yeast Protein NRD1 N0868 YNL251C NRD1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MQQDDDFQNFVATLESFKDLKSGISGSRIKKLTTYALDHIDIESKIISLIIDYSRLCPDSHKLGSLYIIDSIGRAYLDETRSNSNSSSNKPGTCAHAINTLGEVIQELLSDAIAKSNQDHKEKIRMLLDIWDRSGLFQKSYLNAIRSKCFAMDISNNTANTASQQLSLDPKQRSKQILSNLKKSPPLNLNISLPTDLTSTDPAKQQAALFQVIAALQKHFKTLPSHTSVGTVAPPQAHTITEYGSRRERERERERYNSRRNRSRSPPAPFSQPSTGRKDRYPSVAQDQYSIGAPNTTFGTNNHHLYPDELNVSNNPHYRPKPVSYDSTLPPDHIKVYSRTLFIGGVPLNMKEWDLANVLKPFAEVQSVILNNSRKHAFVKVYSRHEAENVLQNFNKDGALPLRTRWGVGFGPRDCCDYQHGYSIIPMHRLTDADKKWSVSAQWGGTSGQPLVTGIVFEEPDIIVGEGVSSKAISQKMPTDSGRNGPRSGKPNKSGSISSISPVPYGNAPLASPPPQQYVQPMMQQPYGYAPNQPLPSQGPAAAAPPVPQQQFDPTAQLNSLMNMLNQQQQQQQQS 75082BDB0C42AE37 75082BDB0C42AE37 cth2 yeast Tis11_Cth2 YLR136C mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast ATGTGGGCTCAATTATCATATACTAGACCAGAATCTCAGAAGACTGACTTAACGTCGTTGTTTTCCACAGATCAAGAGCAAAATCCATTAAATGACTACCAGTACCAGATCAATATTAGGGAACTGGAGGAGTATTACAACAAGACGATTTTAAACGAGGATAACATACAGGAAACAAGCAGTGAAATATCTTCGGCAGTTTCATTCTCTCCACCAAAAAATACAAACGCTATTCAACCGGGGCTACTGTATGATCCACAGTTAATGAACCCTTTTCTCCCATCCGCTCACCTGAATAGCACGGCACCTACTACTTTTAAAAAGAAACTAGAGGTACAAATAAATCCGGACTATGTCCCAAAATCTTCACAATTACCATTAACTTCACAGAATTTGCAACAGTTGTCTCAACAAAAGCCCAAAAATGATGCTTCTTTTTCATCAGAGAAGGAATCCTCAGCTCAACCTAAGGTGAAAAGCCAAGTGCAGGAAACTCCCAAACAATTATACAAGACAGAGCTGTGCGAATCATTCACTTTAAAAGGAAGTTGCCCTTATGGCAGTAAGTGTCAGTTTGCTCACGGACTCGGCGAATTAAAGGTTAAGAAATCGTGCAAGAATTTCAGGACGAAGCCCTGTGTGAATTGGGAGAAACTAGGTTATTGTCCTTATGGCAGAAGATGCTGCTTCAAACATGGCGACGACAACGACATTGCTGTTTACGTGAAAGCTGGTACTTACTGTAACGTCTCTTCGACTAGCAAACAATCAGACGAAAAGAGAAGCAATGGTCGCGGCTCCGCCAAGAAGAAGAATCTAAATGTTAAAGTAAAGGCTTTGCAGAGAATGACCTGGTGA trna pro ugg precursor trna pro ugg precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCGACTTCCTGAATAAACAGGAAGACAAAGCATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC trna arg ccg trna arg ccg trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUCCUCUAGUGCAAUGGUUAGCAUGCAUUCUUCCGGUGGCUGUGAUCCGGGUUCGAGUCCCGGGAGGAGCU ura1_ykl216w URA1 YKL216W mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast trna val cac trna val CAC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GUUCCAAUAGUGUAGCGGCUAUCACGUUGCCUUCACACGGCAAAGGUCCCGAGUUCGAUCCUCGGUUGGAACA snr76 yeast small nuclear RNA 76 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AAUGGAAAUGAGGAUCCACAGCACUGGGCACUGAGGGGGAAACAAAUAUCCUUUCAAAUGAGUGACAAUGCUUUAGCGGGCCUAGAAAACCCGCGCAACUGAUCCAUUG snr75 yeast small nucleolar RNA 75 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UUAUGAUGAGAUAUUUAUAGAUGACGAGUCUGAUCAUUCGUGAAGACACAACUAUUAAAAUUACCAUUCAUGCCUUUCUGAAGCUGUUU snr45 yeast small nucleolar RNA 45 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AUGACCUUCCAAGUUUUUAAAAGAAUACGAUGAUAUUAUUUGCGUUUCAAAUCGAACAAUUCUUCUCGGAGCGAUCUGAGGUUUUAAUGGAGAUAGCGGUUCCUGCGCAACCCAUUGAUCUUGUUACAUUCUUAAGAAUGACAAGGACGCUUUUAUAAAAUUCUGAUUCUUU trna lys cuu tRNA Lys CUU yeast trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCCUUGUUGGCGCAAUCGGUAGCGCGUAUGACUCUUAAUCAUAAGGUUAGGGGUUCGAGCCCCCUACAGGGCU ahp1_ylr109w AHP1 YLR109W mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast snr19_u1_yeast SNR19 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AUACUUACCUUAAGAUAUCAGAGGAGAUCAAGAAGUCCUACUGAUCAAACAUGCGCUUCCAAUAGUAGAAGGACGUUAAGCAUUUAUCAUUGAACUAUAAUUGUUCAUUGAAGUCAUUGAUGCAAACUCCUUGGUCACACACACAUACGGCGCGGAAGGCGUGUUUGCUGACGUUUCCAUUCCCUUGUUUCAAUCAUUGGUUAAUCCCUUGAUUCCUUUGGGGAUUUUUGGGUUAAACUGAUUUUUGGGGCCCUUUGUUUCUUCUGCCUGGAGAAGUUUGACACCAAAUUCAAAUUGGUGUUAGGGGAGCUGGGGCCUUUCAAAAGAGAGCUUUGUAGAGGCAUUCUUUUUGACUACUUUUCUCUAGCGUGCCAUUUUAGUUUUUGACGGCAGAUUCGAAUGAACUUAAGUUUAUGAUGAAGGUAUGGCUGUUGAGAUUAUUUGGUCGGGAUUGUAGUUUGAAGAUGUGCUCUUUUGAGCAGUCUCAACUUUGCUCGUUCCCGUUAUGGGAAAAAUUUUGGAAGGUCUUGGUAGGAACGGGUGGAUCUUAUAAUUUUUGAUUUAUUUU snr50 yeast small nuclear RNA 50 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UUAGAAUGAUGAAAGAGGUAGCAAUUUGCAGCAGAUUUUUCGUGAUUGAAUCAAACAAAGAUUAACCUUUACAGAACCGCUACACUGAUA tlc1_yeast_rna Yeast integral telomerase RNA template component, TLC1 rna ribonucleic acid RNA rna yeast Saccharomyces cerevisiae Baker's yeast AAUAAAACUAGAGAGGAAGAUAGGUACCCUAUGAAAAUGUCAAUGGCUGUUGCGUUUGCUUAAUCGUAUUUUUUUUUUUUUCAGUCCGUGUUUUUUGUACAUUCUACGUUUGAGUUUUCCAUCAUGCAGGCCUCAGAAAUUUGGUAGGCACUCGAUGGUGAAGAGAUAGUGUCGGAUUUCGGAUUGAUCUUUCAGUUGAUAGCCUGCUGCUCUUUUCUUUUCCAAAGAAUUUCGAGUAUGCUGGUGUCAGUGUAGAUGCUUGUGUGUGCGCAAUUUGUGGUUUUUUAUUGUGUUUCUACUUAUAGAUGGCUAAAAUCUGAGUUUAGAAAAUGCAAACCGUAAAUUCUUAAACACUGCUAUUGCAUUUAGUUGCUAAAGCAGUGUUUUUGAACUUAUUCCUGUUAUUCCUUCUUCGUACCGAUCCUCUUCUCGACCUAACCUUUUAAUUACCAUGGGAAGCCUACCAUCACCACACCCACACACAAAUGUUACAGCUAAUUGUUUAUUAGCAAAGUUUGCACGAGUUCGCUGUUUAUUUUUUUCUCGUUUUCUUAUACCUAGUAUUUUUUCUGACACUGUUUAAGGUGACAGAAAAAAAGGAGUUUAAGUUAGAUUUGCAAACAGACGGUGCUAAGCGCUGUCACUUUAUGUCUAUCUUAUCGUUAACUCUGGAAAAAGAAAAAGGAAAAAGAACGUCAGGGAACAUGAGUAUAUAUAGAAAUGGUUUAUUCUAGUUUUUUCCGUUUUUUCAGUAGAUUUUUGCCUUUAAAAGAAUAAAUCCCACUACAAAAAGGUAAAAUAAAAAAUCUAUUCACUGAACUUACUGAUGAAAUUUCCAAAUGUGCCCCGUACAUCGAACGAUGUGACAGAGAAAAAUACGAGUAGGUAAAUAAGCCAAAAGGCAAGGGUGUCCUUUCUUAAGCAUCGGUUAGGUUUGCGGGCGAUCAGUAACUGAACAAUGACACAAGAUCAAGAACGUAAUUUGAGAUUUUUCAAGAUGGUUUUUUUAGGUAUCUAUUAAAACUACUUUGAUGAUCAAUACGGUAUUUUUGUCGCAUUAUUUUCCAAGCGGAAGGAACCGUGUGUUCAUUUUAUGAAUCUUGGUGUUGUAUUCACAGCUACUUCUCCUAAUGCCUUCGAUGCAUUUAGAUAAUUUUUGGAAACAUUUUUUUUCUUGAUGUAUAUUUUUUGUAUUGUAGAAAUCGCGCGUACUGUACUUGUAUAUCGCUUUAUAAGCGCUUUUAAUUGAUUGUUCAUGACGAGGAUAGGCGGAUAGGCGGAGGUAUGCCUCUUAAUAUUUA TLC1 RNA contains a template sequence that Est2p uses to add irregular repeats of TG(1-3) residues onto a DNA end; RNA template component of telomerase snr73 yeast small nucleolar RNA 73 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast GUUUAUGAUGAUUUCCACAUUUCACGACGGUCAACUGCGUUUUUCGAAUGUUUAUCGAUUAACUUUGAUGAUAUUUCGCCUGUGACAGGGCGUGGUACUGAGCUUU sna3_yjl151c Sna3 YJL151C mrna messenger rna mRNA mrna yeast Saccharomyces cerevisiae Baker's yeast trna thr cgu trna thr cgu trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCCCUUUUGGCCAAGUGGUAAGGCAUCGCACUCGUAAUGCGGGGAUCGUGGGUUCAAUUCCCACAGAGGGCA rpr1 yeast RNaseP RNA RPR1 rna ribonucleic acid RNA rna yeast Saccharomyces cerevisiae Baker's yeast GUGGAACAGUGGUAAUUCCUACGAUUAAGAAACCUGUUUACAGAAGGAUCCCCACCUAUGGGCGGGUUAUCAGAUAUUAUCAGGUGGGAAAUUCGGUGGAACACAGUGGAGCCUUGUCCUCCGGGUUAAUGUCGCUUUUGGCAUUGGCCCCUGCUCCUGAGAGAAGAAAUAUACUGGGGAACCAGUCUUUACCGACCGUUGUUAUCAGAAAUUCACGGAGUUCGGCCUAGGUCGGACUCCGAUGGGAACGGCAACGGUUGUUCCGUUUGACUUGUCGCCCGCUACGGCGUGAGCGUCAAGGUCUGUUGAGUGCAAUCGUAGGACGUCAUUAGUGGCGAACCCGAUACCGAUUACUGCUGCUGUUCCAGC snr3 yeast small nucleolar RNA 3 yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AACUUUGUCCUAAAGUACUAAUCCACCGCAUUAGACAGUACGAAGAUCGAGCUAUUUAUUUGAACACUCGGUCUUAUUCGUGAUAAGCGUAAUGUGGAGAGAUCAAUUUCCGGGUCAUUUAUAAGAACUCGAGUGGAUUGCUAGUUGUUUUGAUUAGCUGAAUGAGACUCGAGUGUCAGAAGAUGACUAUAUUU snr78 yeast small nuclear RNA 78 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UCCCUUGAUGACCAAAAUAAAUUUUUACAAACUAGAGUUUCUGAAUCUUUUGUGAUUAGAACGUUUAUUCUUAUUUCUGAGGUUUUU lsr1_snr20_u2 yeast small nuclear RNA U2 yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast ACGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUGUAGUAUCUGUUCUUUUCAGUGUAACAACUGAAAUGACCUCAAUGAGGCUCAUUACCUUUUAAUUUGUUACAAUACACAUUUUUUGGCACCCAAAAUAAUAAAAUGGACGGGAAGAGACUUUUUAAGCAAGUUGUUUUCCGCUAAUGUCAGGUCUCACUACUUUUUGCUGCUAUUUUUCUUCGCUCAUGGUUUCUUCAUAAGGCGUUUUUAUGAUGGUUUUUCGAAAUUGGUUUUUGAGACGACGGUUGCUCAAGGUUAUUGUUUUUGUUUUCUUCUGGUUGUUUUCUAUUUUCUUUUUUUUAGCUUUCUGUUUCUCCCUUAGUUUGGCUUUUUGCUUCAUACUCUUCCCUGUCUUUCCGAGCCGUUUAUGUCCAACGCGGGAUUUGGUUUUUCUUUAUCGAUGGGAAGAAAUGGUGCUAUAGUAGGUUGGGAGAUAAUAUUUAUGGUAUGGGGUGCUAGUGCGGAUGGGGCGCUCUUAUUGUUGAUUUCUUCGCUCGUCUUCUUUUUCUGGUGGCGCUGCAAGAGGAAGUUUUUCGACUUUGUUAUGAUUUUUGGUUUGCAAGGAAAGGUGUCUUACGAUUCUUUUUUUGAUGUAAUAGGAUAAGCUUGCUUAUCCCCCAAGUAUCGGCCAAAGUUGUUGAUUUUCCUUUUGAAGUGUCCUCGGUUUGAGGGGGUGUAGGGUGGGGUUGGUCUACAAUAAGAGUGUUCCAUUGUUAACGUGCUGGCGUCUUUUACUAUAUUUUUUUUCCCAGUUUAUUUUGUGCUUAUUUUCUCAUUGAGGAGAAGGAGCUCUUCUCGCAGGAUAUAAAUGGAGGUUUGCUAAAGGGGAGGAGAUGUGUUUGUGAGAAUACUGCUGAGAGAGUUCUGGAAGAGAAAAAAAGGAGGCAAUGGAAGGCGUUUGCUGGGAAAAGAGAAGAGCCAUGACUGCAUCUGUUGUUUCAAGGCCAGUUUUAUUAACCGCCUAUGUCAUAGAGGCGUUUUUUUUGGAGGGAUUUGAAGAAUGCCGGCGGCAUCAAGAAACGGACUUGAUGGUUGACGCCUGUUUUUAAAGUUAGAGACGUCGCGACCCUCGCACUUGUGGAGUCGUUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGCUCUU rpb2_yeast DNA-directed RNA polymerase II subunit RPB2 YOR151C RPB2 RPB150 RPO22 DNA-directed RNA polymerase II 140 kDa polypeptide B150 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSDLANSEKYYDEDPYGFEDESAPITAEDSWAVISAFFREKGLVSQQLDSFNQFVDYTLQDIICEDSTLILEQLAQHTTESDNISRKYEISFGKIYVTKPMVNESDGVTHALYPQEARLRNLTYSSGLFVDVKKRTYEAIDVPGRELKYELIAEESEDDSESGKVFIGRLPIMLRSKNCYLSEATESDLYKLKECPFDMGGYFIINGSEKVLIAQERSAGNIVQVFKKAAPSPISHVAEIRSALEKGSRFISTLQVKLYGREGSSARTIKATLPYIKQDIPIVIIFRALGIIPDGEILEHICYDVNDWQMLEMLKPCVEDGFVIQDRETALDFIGRRGTALGIKKEKRIQYAKDILQKEFLPHITQLEGFESRKAFFLGYMINRLLLCALDRKDQDDRDHFGKKRLDLAGPLLAQLFKTLFKKLTKDIFRYMQRTVEEAHDFNMKLAINAKTITSGLKYALATGNWGEQKKAMSSRAGVSQVLNRYTYSSTLSHLRRTNTPIGRDGKLAKPRQLHNTHWGLVCPAETPEGQACGLVKNLSLMSCISVGTDPMPIITFLSEWGMEPLEDYVPHQSPDATRVFVNGVWHGVHRNPARLMETLRTLRRKGDINPEVSMIRDIREKELKIFTDAGRVYRPLFIVEDDESLGHKELKVRKGHIAKLMATEYQDIEGGFEDVEEYTWSSLLNEGLVEYIDAEEEESILIAMQPEDLEPAEANEENDLDVDPAKRIRVSHHATTFTHCEIHPSMILGVAASIIPFPDHNQSPRNTYQSAMGKQAMGVFLTNYNVRMDTMANILYYPQKPLGTTRAMEYLKFRELPAGQNAIVAIACYSGYNQEDSMIMNQSSIDRGLFRSLFFRSYMDQEKKYGMSITETFEKPQRTNTLRMKHGTYDKLDDDGLIAPGVRVSGEDVIIGKTTPISPDEEELGQRTAYHSKRDASTPLRSTENGIVDQVLVTTNQDGLKFVKVRVRTTKIPQIGDKFASRHGQKGTIGITYRREDMPFTAEGIVPDLIINPHAIPSRMTVAHLIECLLSKVAALSGNEGDASPFTDITVEGISKLLREHGYQSRGFEVMYNGHTGKKLMAQIFFGPTYYQRLRHMVDDKIHARARGPMQVLTRQPVEGRSRDGGLRFGEMERDCMIAHGAASFLKERLMEASDAFRVHICGICGLMTVIAKLNHNQFECKGCDNKIDIYQIHIPYAAKLLFQELMAMNITPRLYTDRSRDF BABD03212C0A583E BABD03212C0A583E snr11 yeast small nucleolar RNA 11 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast AAUAAUGUCUUUUAUAAUAGACACCCAGAGUCACGAUUCGUCUUGGUUUUAGAGAUUCUGUUUCGACAGUUUUUUUAGGCGGUGGACGUAUAUAGUUUACUUAAUCGUUUACUAUACGGUGGAGUACUAAUACUAUUUCACUGUCGUGCUCGCGGUUGAUCUUAGAUAAAUAUAUUUCUUUUUCAUAAAGAAAGUGAGUGGAUCUUCCCUGGAAGUACGAAUAAUGUACUUAUGAUUAGAUUCUCUUCACGCACAUAC snr54 yeast small nuclear RNA 54 Yeast snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UAAGAUGAUGAUCAACUUUUUAUAUCAAUAACUUUCGUUCUACUGACUGUGAUCAAACGAUCUUGUAGAGAACUUUUACUCUGAAU trna phe gaa precursor trna Phe GAA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGACUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAAAAACUUCGGUCAAGUCAUCUGGAGGUCCUGUGUUCGAUCCACAGAGUUCGCA snr77 yeast small nucleolar RNA 77 snorna small nucleolar rna snoRNA snorna yeast Saccharomyces cerevisiae Baker's yeast UUCAUAUGAUGAUUAUAACAAAAACAAAAGCUGGAAUUACUGGCUGAACGAGUAUAUGUUGAUACGUUUUUGCACUAUCCUGACCUAG trna leu gag trna Leu GAG trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGUACUCUGGCCGAGUGGUCUAAGGCGUCAGGUCGAGGUCCUGAUCUCUUCGGAGGCGCGGGUUCAAACCCCGCGGGUAUCA nrd1-snr74 yeast-1 2 9 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr74 maturation and binds downstream the mature snRNA 3' end rpb2-snr13 yeast-1 2 4 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 2 nab3-snr13 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 2 This protein is involved in snr13 maturation and binds 10-50 nucleotides downstream the mature snRNA rpb2-snr11 yeast-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 32 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3A rpb2-snr5 yeast-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3B rpb2-snr40 yeast-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3D rpb2-snr45 yeast-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 18 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3C nab3-snr11 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 32 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3A nab3-snr5 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3B nab3-snr40 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed cell lysate cell lysate engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role prey prey cell lysate cell lysate physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3D nab3-snr45 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed cell lysate cell lysate engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 18 unspecified role unspecified role prey prey cell lysate cell lysate physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3C nrd1-snr11 yeast-1 2 32 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 3A, Fig5B,C This protein is involved in snr11 maturation and mainly binds downstream the mature 3' end. In the absence of glucose a second binding region appears within the mature snorna. nrd1-snr5 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3B nrd1-snr45 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 18 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3C nrd1-snr40 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 3D sen1-snr11 yeast-1 2 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 32 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig3A sen1-snr5 yeast-1 2 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig3B nrd1-snr50 yeast-1 2 22 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4A,B This protein is involved in snr50 maturation and mainly binds upstream the mature 5' end nab3-snr54 yeast-1 2 33 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4C nrd1-snr54 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 33 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 4C nab3-snr74 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 9 unspecified role unspecified role prey prey cell lysate cell lysate physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 4D This protein is involved in snr74 maturation and binds downstream the mature snRNA nab3-snr72 yeast_1-1 2 8 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr72 maturation and binds downstream the mature snRNA nab3-snr73 yeast-1 2 24 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr73 maturation and binds downstream the mature snRNA nab3-snr78 yeast-1 2 29 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr78 maturation and binds downstream the mature snRNA nrd1-snr77 yeast-1 2 35 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr77 maturation and binds downstream the mature snRNA 3' end nrd1-snr73 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 24 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 4D This protein is involved in snr73 maturation and binds downstream the mature snRNA 3' end nrd1-snr76 yeast-1 2 16 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr76 maturation and binds downstream the mature snRNA 3' end nrd1-snr78 yeast-1 2 29 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr78 maturation and binds downstream the mature snRNA 3' end nrd1-snr3 yeast-1 2 28 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig5A This protein is involved in snr3 maturation and mainly binds downstream the mature 3' end. In the absence of glucose a second binding region appears within the mature snorna. nrd1-snr13 yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag his Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 2 This protein is involved in snr13 maturation and binds downstream the mature snRNA nrd1-snr19_u1_yeast-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 21 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 6A This protein is involved in snr19 maturation and mainly binds downstream the mature 3' end. nrd1-lsr1_snr20_u2 yeast-1 2 30 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 6B This protein is involved in snr19 maturation and mainly binds downstream the mature 3' end. I nrd1-tlc1_yeast_rna-1 2 23 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 6C This protein is involved in tlc1 RNA maturation and mainly binds downstream the mature 3' end in the precursor RNA. nrd1-cth2 yeast-1 2 11 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 7A This protein is involved in mRNA maturation and mainly binds downstream the mature 3' end. nrd1-ahp1_ylr109w-1 2 20 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 7B This protein is involved in mRNA maturation and mainly binds downstream the mature 3' end. nrd1-ura1_ykl216w-1 2 14 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 7C This protein is involved in mRNA maturation and mainly binds downstream the mature 3' end. nrd1-sna3_yjl151c-1 2 25 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 7D This protein is involved in mRNA maturation and mainly binds downstream the mature 3' end. sen1-ylr109w-1 2 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 20 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 7B sen1-ura1_ykl216w-1 2 14 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 7C nab3-trna phe gaa precursor-1 2 34 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 8B nab3-trna pro ugg precursor-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 8A nrd1-trna phe gaa precursor-1 2 34 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 8B rpb2-trna pro ugg precursor-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 8A rpb2-trna phe gaa precursor-1 2 31 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 34 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 8B sen1-trna phe gaa precursor-1 2 34 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 8B sen1-trna pro ugg precursor-1 2 3 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 12 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 8A nrd1-trna thr cgu-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 26 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-trna pro ugg precursor-2 2 12 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 8A, 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-trna val cac-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 15 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-trna leu gag-1 2 36 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-rpr1 yeast-1 2 27 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 9B This protein may be involved in RNA regulation. The binding only appears In the absence of glucose. nrd1-trna lys cuu-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 19 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-trna arg ccg-1 2 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 9A This protein may be involved in tRNA regulation. The binding only appears In the absence of glucose. nrd1-snr72 yeast_1-1 2 8 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr11 maturation and mainly binds downstream the mature 3' end. In the absence of glucose a second binding region appears within the mature snorna. nab3-snr75 yeast-1 2 17 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr74 maturation and binds downstream the mature snRNA nab3-snr76 yeast-1 2 16 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig 4D This protein is involved in snr74 maturation and binds downstream the mature snRNA nab3-snr77 yeast-1 2 6 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTB tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 35 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level association association Fig 4D This protein is involved in snr74 maturation and binds downstream the mature snRNA nrd1-snr3 yeast-2 1 28 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig5A This protein is involved in snr3 maturation and mainly binds downstream the mature 3' end. In the absence of glucose a second binding region appears within the mature snorna. nrd1-snr11 yeast-2 1 32 unspecified role unspecified role prey prey living cell living cell physiological level physiological level endogenous level endogenous endogenous endogenous level 10 unspecified role unspecified role bait bait over-expressed over expressed level over-expressed living cell living cell engineered engineered HTV tag His Tev Biotin tag tandem tag tandem tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig5B,C This protein is involved in snr11 maturation and mainly binds downstream the mature 3' end. In the absence of glucose a second binding region appears within the mature snorna.