IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The yeast tRNA:pseudouridine synthase Pus1p displays a multisite substrate specificity. The yeast tRNA:pseudouridine synthase Pus1p displays a multisite substrate specificity. RNA (New York, N.Y.) 1998 imex curation Motorin Y., Keith G., Simon C., Foiret D., Simos G., Hurt E., Grosjean H. henri.grosjean@lebs.cnrs-gif.fr 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Motorin Y., Keith G., Simon C., Foiret D., Simos G., Hurt E., Grosjean H. To detect the precence of pseudouridine, tRNAs were digested by endonucleases and resolved on TLC henri.grosjean@lebs.cnrs-gif.fr Accepted 2016-JUL-11 AT 09:39 BST AT 09:39 BST by ORCHARD RNA (New York, N.Y.) 1998 imex curation from p 858 paragr tRNA ile minisubstrates. The region 35-97 should correspond to anticodon + 60 nucleotide of intron. I have corrected with 34-97, but this does not concern 27 modif. So I have substituted sufficient to bind with binding region. Should I create a separate entry instead? 27/06 Ok I have left required to bind (according to the text) for mod 34 and 36 and create a separate entry for 27 trna val uac trna Val UAC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGUCCAAUGGUCCAGUGGUUCAAGACGUCGCCUUUACACGGCGAAGAUCCCGAGUUCGAACCUCGGUUGGAUCA trna ile uau trna ile uau trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAACGCGACCGUCGUGGGUUCAAACCCCACCUCGAGCA trna_asp_guc tRna Asp GUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGUGAUAGUUUAAUGGUCAGAAUGGGCGCUUGUCGCGUGCCAGAUCGGGGUUCAAUUCCCCGUCGCGGAG pus1_yeast tRNA pseudouridine synthase 1 YPL212C tRNA-uridine isomerase 1 PUS1 tRNA pseudouridylate synthase 1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSEENLRPAYDDQVNEDVYKRGAQSKLTKARKADFDDEKDKKKDNDKHIDKRPKSGPRLDENGNPLPKEPRLPKRKVAVMVGYCGTGYHGMQYNPPNPTIESALFKAFVEAGAISKDNSNDLKKNGFMRAARTDKGVHAGGNLISLKMIIEDPDIKQKINEKLPEGIRVWDIERVNKAFDCRKMCSSRWYEYLLPTYSLIGPKPGSILYRDIEESKTELPGVLDEDLESKEFWEEFKKDANEKFSTEEIEAILAYVPPARDEFDINEELYQKVKKYKQLENAHRRRYRISAAKLAKFRASTSQYLGAHNFHNFTLGKDFKEPSAIRFMKDIKVSDPFVIGDAQTEWISIKIHGQSFMLHQIRKMVSMATLITRCGCPVERISQAYGQQKINIPKAPALGLLLEAPVFEGYNKRLEQFGYKAIDFSKYQDEVDKFKMKHIYDKIYKEEVDENVFNAFFSYIDSFNKVTGAQGEETADKSGPAVQKSIFEFLTAKGIPGLTDAPESNKKIKQRKRMEEEEAASKKAEISSTTQSNEPEVQPEAAAN 1A7E449601C26EFD trna trp cca tRNA Trp CCA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GAAGCGGUGGCUCAAUGGUAGAGCUUUCGACUCCAAAUCGAAGGGUUGCAGGUUCAAUUCCUGUCCGUUUCA trna ile uau precursor tRNA Ile UAU precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCUCGUGUAGCUCAGUGGUUAGAGCUUCGUGCUUAUAGCAACAUUCGGUUUCCGAAGUUUCUGUGCCAAAGACCUUUCAAACAGGCCUUUAAAAGCAACGCGACCCGUCGUGGGUUCAAUCCCCACCUCGAGCA trna tyr gua precursor tRNA Tyr GUA precursor trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast CUCUCGGUAGCCAAGUUGGUUUAAGGCGCAAGACUGUAAUUUAUCACUACGAAAUCUUGAGAUCGGGCGUUCGACUCGCCCCCGGGAGA pus1-trna ile uau-1 1 3 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification mobility shift mobility shift certain certain sequence position certain certain certain sequence position certain 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3A pus1-trna val uac-1 1 2 enzyme target enzyme target substrate substrate neutral component neutral component Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined U35C,C37U mutation mutation certain certain sequence position certain certain certain sequence position certain U C certain certain sequence position certain certain certain sequence position certain C U 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3D pus1-trna trp cca-1 1 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 6 primer extension assay primer extension assay primer extension assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra enzyme target enzyme target substrate substrate neutral component neutral component Pseudouridine 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain C34U mutation mutation certain certain sequence position certain certain certain sequence position certain C U label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined To localizethe pseusouridine, RNA was incubated with CMCT then analysed with primer extension enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3D, Fig 5 pus1-trna ile uau precursor-1 1 7 enzyme target enzyme target substrate substrate neutral component neutral component region required to bind necessary binding region required to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification mobility shift mobility shift certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3A,B, Fig4 pus1-trna tyr gua precursor-1 1 8 enzyme target enzyme target substrate substrate neutral component neutral component Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3C pus1-trna_asp_guc-1 1 5 enzyme enzyme neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain C27U,C28U,G42A,G43A mutation mutation certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig3D