IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Characterization of yeast protein Deg1 as pseudouridine synthase (Pus3) catalyzing the formation of psi 38 and psi 39 in tRNA anticodon loop. Characterization of yeast protein Deg1 as pseudouridine synthase (Pus3) catalyzing the formation of psi 38 and psi 39 in tRNA anticodon loop. The Journal of biological chemistry 1998 imex curation Lecointe F., Simos G., Sauer A., Hurt EC., Motorin Y., Grosjean H. Yuri.Motorin@lebs.cnrs-gif.fr 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lecointe F., Simos G., Sauer A., Hurt EC., Motorin Y., Grosjean H. Yuri.Motorin@lebs.cnrs-gif.fr Accepted 2016-OCT-20 AT 09:20 BST AT 09:20 BST by MGT The Journal of biological chemistry 1998 imex curation trna ala agc tRNA ala AGC yeast trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGGCGUGUGGCGUAGUCGGUAGCGCGCUCCCUUAGCAUGGGAGAGGUCUCCGGUUCGAUUCCGGACUCGUCCA pus3_yeast tRNA pseudouridine(38/39) synthase YFL001W DEG1 HRM3 tRNA-uridine isomerase 3 tRNA pseudouridylate synthase 3 Depressed growth-rate protein DEG1 PUS3 tRNA pseudouridine synthase 3 protein protein yeast Saccharomyces cerevisiae Baker's yeast MSNFIRRLVGKMKAISTGTNAIVSKKDSIYANWSKEQLIRRITELENANKPHSEKFQHIEDNKKRKISQEEVTRSKAKKAPKKFDFSKHNTRFIALRFAYLGWNYNGLAVQKEYTPLPTVEGTILEAMNKCKLVPSMVLQDYKFSRCGRTDKGVSAMNQVISLEVRSNLTDEEQRDPTNDSREIPYVHVLNQLLPDDIRISAVCLRPPPNFDARFSCVHRHYKYIFNGKNLNIEKMSKAASYFVGERDFRNFCKLDGSKQITNFKRTIISSKILPLSETFYCFDLVGSAFLWHQVRCMMAILFLVGQSLEVPEIVLRLTDIEKTPQRPVYEMANDIPLLLYDCKFPEMDWQEPTVDDYKAIKFTTATEALTLHYELKAAVCNIFKDVLPTANTNNFSKTIINLGDGRGKVVGTYVKLEDRSVMEPVEVVNAKYSKKKNNKNK 89C35917366BDB9B 89C35917366BDB9B trna phe gaa trna Phe GAA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA deg1-trna phe gaa-1 1 4 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain mutation mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain C G certain certain sequence position certain certain certain sequence position certain G C in vitro In vitro 3 enzyme enzyme neutral component neutral component tag protein a tag protein a tag protein A protein A n-term range n-terminal range n-term range n-term range n-terminal range n-term range yeast Saccharomyces cerevisiae Baker's yeast enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig 4B deg1-trna ala agc-1 1 3 enzyme enzyme neutral component neutral component tag protein a tag protein a tag protein A protein A n-term range n-terminal range n-term range n-term range n-terminal range n-term range yeast Saccharomyces cerevisiae Baker's yeast 2 enzyme target enzyme target substrate substrate neutral component neutral component label 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Pseudouridine rna chemical modification RNA chemical modification RNA chemical modification post-transcriptional modification rna chemical modification certain certain sequence position certain certain certain sequence position certain in vitro In vitro enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction Fig 4B