IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The crystal structure of yeast mitochondrial ThrRS in complex with the canonical threonine tRNA. The crystal structure of yeast mitochondrial ThrRS in complex with the canonical threonine tRNA. Nucleic acids research 2016 imex curation Holman KM., Wu J., Ling J., Simonović M. msimon5@uic.edu 20-Dec-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Holman KM., Wu J., Ling J., Simonović M. msimon5@uic.edu Accepted 2016-OCT-21 AT 14:13 BST AT 14:13 BST by MGT Nucleic acids research 2016 imex curation trna thr ugu tRNA thr UGU as reported in pdb 4YYE trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GUUAUAUUAGCUUAAUUGGUAGAGCAUUCGUUUUGUAAUCGAAAGGUUUGGGGUUCAAAUCCCUAAUAUAACACCA the sequence is completely different from other yeast tRNA thr UGU sequences present in RNA central sytm_yeast Threonine--tRNA ligase, mitochondrial MST1 Threonyl-tRNA synthetase YKL194C protein protein yeast Saccharomyces cerevisiae Baker's yeast MKIQLVRWHCSRNALWNRAFYSTRKATKNASSATPATMTSMVSQRQDLFMTDPLSPGSMFFLPNGAKIFNKLIEFMKLQQKFKFGFNEVVTPLIYKKTLWEKSGHWENYADDMFKVETTDEEKEEYGLKPMNCPGHCLIFGKKDRSYNELPLRFSDFSPLHRNEASGALSGLTRLRKFHQDDGHIFCTPSQVKSEIFNSLKLIDIVYNKIFPFVKGGSGAESNYFINFSTRPDHFIGDLKVWNHAEQVLKEILEESGKPWKLNPGDGAFYGPKLDIMVTDHLRKTHQVATIQLDFQLPERFDLKFKDQDNSYKRPIMIHRATFGSIERFMALLIDSNEGRWPFWLNPYQAVIIPVNTKNVQQLDMCTALQKKLRNELEADDMEPVPLNDWHFNVDLDIRNEPVGYRIKSAILKNYSYLIIVGDEEVQLQKYNIRERDNRKSFEKLTMSQIWEKFIELEKNYK BC90DED57EB037BF trna thr-1 1 3 unspecified role unspecified role neutral component neutral component tag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 2 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction Table 1 Rfree 20%, Rwork 16% 2.3 A The tRNA thr UGU they used for the crystal has a different sequence from other tRNA thr UGU annotated in RNA central.