IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Genes & development 2012 imex curation Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast crac crac CRAC cross-linking and analysis of cDNAs crac partial nucleotide sequence partial nucleotide sequence identification partial nucleotide sequence Hahn D., Kudla G., Tollervey D., Beggs JD. Brr2 was HTP tagged- a tandem -His-TEV-Protein A tag. j.beggs@ed.ac.uk Accepted 2016-MAY-26 AT 11:46 BST AT 11:46 BST by MGT Genes & development 2012 imex curation Done. The complex cannot be made but Sandra suggested the linking features. From Fig 2 I can guess the regions for U4-U6 binding but it is not an experiment of this article. Do you think I should add it in the range? Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Genes & development 2012 imex curation Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk Accepted 2016-MAY-26 AT 11:46 BST AT 11:46 BST by MGT Genes & development 2012 imex curation Done. The complex cannot be made but Sandra suggested the linking features. From Fig 2 I can guess the regions for U4-U6 binding but it is not an experiment of this article. Do you think I should add it in the range? Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Genes & development 2012 imex curation Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro comigration in gel comigration in gel electrophoresis comigration in gel weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Hahn D., Kudla G., Tollervey D., Beggs JD. j.beggs@ed.ac.uk Accepted 2016-MAY-26 AT 11:46 BST AT 11:46 BST by MGT Genes & development 2012 imex curation Done. The complex cannot be made but Sandra suggested the linking features. From Fig 2 I can guess the regions for U4-U6 binding but it is not an experiment of this article. Do you think I should add it in the range? snr7s_u5_yeast small nuclear RNA U5 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AAGCAGCUUUACAGAUCAAUGGCGGAGGGAGGUCAACAUCAAGAACUGUGGGCCUUUUAUUGCCUAUAGAACUUAUAACGAACAUGGUUCUUGCCUUUUACCAGAACCAUCCGGGUGUUGUCUCCAUAGAAACAGGUAAAGCUGUCCGUUACUGUGGGCUUGCCAUAUUUUUUGGAACU snr14_u4_yeast SNR14 snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast AUCCUUAUGCACGGGAAAUACGCAUAUCAGUGAGGAUUCGUCCGAGAUUGUGUUUUUGCUGGUUGAAAUUUAAUUAUAAACCAGACCGUCUCCUCAUGGUCAAUUCGGUGUUCGCUUUUGAAUACUUCAAGACUAUGUAGGGAAUUUUUGGAAUACCUUU brr2_yeast Pre-mRNA-splicing helicase BRR2 BRR2 RSS1 SNU246 YER172C SYGP-ORF66 Protein Snu246 protein protein yeast Saccharomyces cerevisiae Baker's yeast MTEHETKDKAKKIREIYRYDEMSNKVLKVDKRFMNTSQNPQRDAEISQPKSMSGRISAKDMGQGLCNNINKGLKENDVAVEKTGKSASLKKIQQHNTILNSSSDFRLHYYPKDPSNVETYEQILQWVTEVLGNDIPHDLIIGTADIFIRQLKENEENEDGNIEERKEKIQHELGINIDSLKFNELVKLMKNITDYETHPDNSNKQAVAILADDEKSDEEEVTEMSNNANVLGGEINDNEDDDEEYDYNDVEVNSKKKNKRALPNIENDIIKLSDSKTSNIESVPIYSIDEFFLQRKLRSELGYKDTSVIQDLSEKILNDIETLEHNPVALEQKLVDLLKFENISLAEFILKNRSTIFWGIRLAKSTENEIPNLIEKMVAKGLNDLVEQYKFRETTHSKRELDSGDDQPQSSEAKRTKFSNPAIPPVIDLEKIKFDESSKLMTVTKVSLPEGSFKRVKPQYDEIHIPAPSKPVIDYELKEITSLPDWCQEAFPSSETTSLNPIQSKVFHAAFEGDSNMLICAPTGSGKTNIALLTVLKALSHHYNPKTKKLNLSAFKIVYIAPLKALVQEQVREFQRRLAFLGIKVAELTGDSRLSRKQIDETQVLVSTPEKWDITTRNSNNLAIVELVRLLIIDEIHLLHDDRGPVLESIVARTFWASKYGQEYPRIIGLSATLPNYEDVGRFLRVPKEGLFYFDSSFRPCPLSQQFCGIKERNSLKKLKAMNDACYEKVLESINEGNQIIVFVHSRKETSRTATWLKNKFAEENITHKLTKNDAGSKQILKTEAANVLDPSLRKLIESGIGTHHAGLTRSDRSLSEDLFADGLLQVLVCTATLAWGVNLPAHTVIIKGTDVYSPEKGSWEQLSPQDVLQMLGRAGRPRYDTFGEGIIITDQSNVQYYLSVLNQQLPIESQFVSKLVDNLNAEVVAGNIKCRNDAVNWLAYTYLYVRMLASPMLYKVPDISSDGQLKKFRESLVHSALCILKEQELVLYDAENDVIEATDLGNIASSFYINHASMDVYNRELDEHTTQIDLFRIFSMSEEFKYVSVRYEEKRELKQLLEKAPIPIREDIDDPLAKVNVLLQSYFSQLKFEGFALNSDIVFIHQNAGRLLRAMFEICLKRGWGHPTRMLLNLCKSATTKMWPTNCPLRQFKTCPVEVIKRLEASTVPWGDYLQLETPAEVGRAIRSEKYGKQVYDLLKRFPKMSVTCNAQPITRSVMRFNIEIIADWIWDMNVHGSLEPFLLMLEDTDGDSILYYDVLFITPDIVGHEFTLSFTYELKQHNQNNLPPNFFLTLISENWWHSEFEIPVSFNGFKLPKKFPPPTPLLENISISTSELGNDDFSEVFEFKTFNKIQSQVFESLYNSNDSVFVGSGKGTGKTAMAELALLNHWRQNKGRAVYINPSGEKIDFLLSDWNKRFSHLAGGKIINKLGNDPSLNLKLLAKSHVLLATPVQFELLSRRWRQRKNIQSLELMIYDDAHEISQGVYGAVYETLISRMIFIATQLEKKIRFVCLSNCLANARDFGEWAGMTKSNIYNFSPSERIEPLEINIQSFKDVEHISFNFSMLQMAFEASAAAAGNRNSSSVFLPSRKDCMEVASAFMKFSKAIEWDMLNVEEEQIVPYIEKLTDGHLRAPLKHGVGILYKGMASNDERIVKRLYEYGAVSVLLISKDCSAFACKTDEVIILGTNLYDGAEHKYMPYTINELLEMVGLASGNDSMAGKVLILTSHNMKAYYKKFLIEPLPTESYLQYIIHDTLNNEIANSIIQSKQDCVDWFTYSYFYRRIHVNPSYYGVRDTSPHGISVFLSNLVETCLNDLVESSFIEIDDTEAEVTAEVNGGDDEATEIISTLSNGLIASHYGVSFFTIQSFVSSLSNTSTLKNMLYVLSTAVEFESVPLRKGDRALLVKLSKRLPLRFPEHTSSGSVSFKVFLLLQAYFSRLELPVDFQNDLKDILEKVVPLINVVVDILSANGYLNATTAMDLAQMLIQGVWDVDNPLRQIPHFNNKILEKCKEINVETVYDIMALEDEERDEILTLTDSQLAQVAAFVNNYPNVELTYSLNNSDSLISGVKQKITIQLTRDVEPENLQVTSEKYPFDKLESWWLVLGEVSKKELYAIKKVTLNKETQQYELEFDTPTSGKHNLTIWCVCDSYLDADKELSFEINVK DFAF7E3B7168D944 DFAF7E3B7168D944 snru6_yeast small nuclear RNA U6 Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast GUUCGCGAAGUAACCCUUCGUGGACAUUUGGUCAAUUUGAAACAAUACAGAGAUGAUCAGCAGUUCCCCUGCAUAAGGAUGAACCGUUUUACAAAGAGAUUUAUUUCGUUUU lsr1_snr20_u2 yeast small nuclear RNA U2 yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast ACGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUGUAGUAUCUGUUCUUUUCAGUGUAACAACUGAAAUGACCUCAAUGAGGCUCAUUACCUUUUAAUUUGUUACAAUACACAUUUUUUGGCACCCAAAAUAAUAAAAUGGACGGGAAGAGACUUUUUAAGCAAGUUGUUUUCCGCUAAUGUCAGGUCUCACUACUUUUUGCUGCUAUUUUUCUUCGCUCAUGGUUUCUUCAUAAGGCGUUUUUAUGAUGGUUUUUCGAAAUUGGUUUUUGAGACGACGGUUGCUCAAGGUUAUUGUUUUUGUUUUCUUCUGGUUGUUUUCUAUUUUCUUUUUUUUAGCUUUCUGUUUCUCCCUUAGUUUGGCUUUUUGCUUCAUACUCUUCCCUGUCUUUCCGAGCCGUUUAUGUCCAACGCGGGAUUUGGUUUUUCUUUAUCGAUGGGAAGAAAUGGUGCUAUAGUAGGUUGGGAGAUAAUAUUUAUGGUAUGGGGUGCUAGUGCGGAUGGGGCGCUCUUAUUGUUGAUUUCUUCGCUCGUCUUCUUUUUCUGGUGGCGCUGCAAGAGGAAGUUUUUCGACUUUGUUAUGAUUUUUGGUUUGCAAGGAAAGGUGUCUUACGAUUCUUUUUUUGAUGUAAUAGGAUAAGCUUGCUUAUCCCCCAAGUAUCGGCCAAAGUUGUUGAUUUUCCUUUUGAAGUGUCCUCGGUUUGAGGGGGUGUAGGGUGGGGUUGGUCUACAAUAAGAGUGUUCCAUUGUUAACGUGCUGGCGUCUUUUACUAUAUUUUUUUUCCCAGUUUAUUUUGUGCUUAUUUUCUCAUUGAGGAGAAGGAGCUCUUCUCGCAGGAUAUAAAUGGAGGUUUGCUAAAGGGGAGGAGAUGUGUUUGUGAGAAUACUGCUGAGAGAGUUCUGGAAGAGAAAAAAAGGAGGCAAUGGAAGGCGUUUGCUGGGAAAAGAGAAGAGCCAUGACUGCAUCUGUUGUUUCAAGGCCAGUUUUAUUAACCGCCUAUGUCAUAGAGGCGUUUUUUUUGGAGGGAUUUGAAGAAUGCCGGCGGCAUCAAGAAACGGACUUGAUGGUUGACGCCUGUUUUUAAAGUUAGAGACGUCGCGACCCUCGCACUUGUGGAGUCGUUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGCUCUU brr2-1 1 4 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 7 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 5 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain association association fig1, fig 2, fig 3A, B, Fig7, Suppl fig5 mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158 brr2-8 2 6 unspecified role unspecified role prey prey yeast Saccharomyces cerevisiae Baker's yeast 7 unspecified role unspecified role bait bait U4 binding binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 5 unspecified role unspecified role bait bait U6 binding binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 26 23 direct interaction direct interaction Fig 2D, (Supp fig 2) u4_u6-1 3 7 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 5 unspecified role unspecified role neutral component neutral component yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast direct interaction direct interaction Suppl Fig 2 B,C,D brr2-snru6_yeast-1 1 7 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range P32639:p.Gly858Arg mutation mutation certain certain sequence position certain certain certain sequence position certain G R Wed May 02 20:27:47 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly858arg' Tue Jun 30 20:20:05 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly858Arg' association association Fig7 brr2-lsr1_snr20_u2 yeast-1 1 4 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 7 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range P32639:p.Gly858Arg mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain G R Wed May 02 15:37:43 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly858arg' Tue Jun 30 18:53:11 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly858Arg' 5 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association fig1, fig 2, fig 3A, B, Fig7, Suppl fig5-mutation+ mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158 brr2-lsr1_snr20_u2 yeast-2 1 7 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain tag His Tev proteinA tag tandem tag tandem tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range P32639:p.Gly858Arg mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G R Wed May 02 16:49:55 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly858arg' Tue Jun 30 18:50:44 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly858Arg' 5 unspecified role unspecified role prey prey region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association fig1, fig 2, fig 3A, B, Fig7, Suppl fig5-mutation2-less mutation G858R in Brr2 alters the interaction with snRNAs: it increases the one with U5 and U6, decreases the interaction with U2 , it decreases interaction with region 30-80 of U4 and increases it with region 128-158