IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Potential interface between ribosomal protein production and pre-rRNA processing. Potential interface between ribosomal protein production and pre-rRNA processing. Molecular and cellular biology 2007 imex curation Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu Accepted 2017-JAN-25 AT 10:38 GMT AT 10:38 GMT by MGT Molecular and cellular biology 2007 Only protein-protein interactions imex curation imex curation Potential interface between ribosomal protein production and pre-rRNA processing. Potential interface between ribosomal protein production and pre-rRNA processing. Molecular and cellular biology 2007 imex curation Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast affinity chrom affinity chromatography technology Affinity purification Affinity purification affinity chrom anti tag western anti tag western blot anti tag western Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu Accepted 2017-JAN-25 AT 10:38 GMT AT 10:38 GMT by MGT Molecular and cellular biology 2007 Only protein-protein interactions imex curation imex curation Potential interface between ribosomal protein production and pre-rRNA processing. Potential interface between ribosomal protein production and pre-rRNA processing. Molecular and cellular biology 2007 imex curation Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast anti bait coip anti bait coimmunoprecipitation anti bait coip anti tag western anti tag western blot anti tag western Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu Accepted 2017-JAN-25 AT 10:38 GMT AT 10:38 GMT by MGT Molecular and cellular biology 2007 Only protein-protein interactions imex curation imex curation Potential interface between ribosomal protein production and pre-rRNA processing. Potential interface between ribosomal protein production and pre-rRNA processing. Molecular and cellular biology 2007 imex curation Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu Accepted 2017-JAN-25 AT 10:38 GMT AT 10:38 GMT by MGT Molecular and cellular biology 2007 Only protein-protein interactions imex curation imex curation Potential interface between ribosomal protein production and pre-rRNA processing. Potential interface between ribosomal protein production and pre-rRNA processing. Molecular and cellular biology 2007 imex curation Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeast Saccharomyces cerevisiae Baker's yeast affinity chrom affinity chromatography technology Affinity purification Affinity purification affinity chrom ms participant Identification by mass spectrometry ms participant Rudra D., Mallick J., Zhao Y., Warner JR. Density gradient expts not added since no pre-purification warner@aecom.yu.edu Accepted 2017-JAN-25 AT 10:38 GMT AT 10:38 GMT by MGT Molecular and cellular biology 2007 Only protein-protein interactions imex curation imex curation rs6a_yeast_gene gene gene yeast Saccharomyces cerevisiae Baker's yeast fhl1_yeast Pre-rRNA-processing protein FHL1 P8283.15 YPR104C FHL1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MDGEMAIIESSNHVGTSSPTTETQFTIDSSALKDQETKESITNSPTSEVPIETKLPKSSDIVTEEKHPQNTTTDIENEVENPVTDDNGNLKLELPDNLDNADFSKLLEFDAKNDEALFNSNELLSHTMDPVNNIDLTHDHSREVSSKEDINIEPVNPDEDEREKTQDNTAAVKTEGIRNSEDTSIQKDEPTADAIYTDVHKLSVNKDTETLPTLVDEKNNMLHMRNNSITPIMFQQHELVGQPPQNTVTENNSTDAETTQRKLSEPIDASLPLPNEQPTIFAYARLDFQSFTFYVQTLHAIIGRRSENDFSHKVDVNLGPSKSISRRHAQIFYNFGTGRFELSIIGKNGAFVDDIFVEKGNTVPLRNKTKIQIGQIPFQFILPEQERNDDSKSPENADIAESEINTRNLKKNEPKSKKKITTGAKPKKAQTKPAVKKEKKPPKIPKKVYTLEEIPVEYRTKPTVSYSAMLTTCIRKYSTAKGMSLSEIYAGIRELFPYYKYCPDGWQSSVRHNLSLNKSFRKVSKEGKGWLWGLDEEYIAERERQKKKQSEIAVAKAQAAQLKLEQQQHKLQQVPQRGKKDIVSQRSNVNARKQNISQTLAANRAASNRKNTASDNQRTMKYLQEQLVILTRDRKGLSKQVIAAILTQALAMTINQVTQAAKNKGITGNPLTALMDKNPQHLNLILAAAVNAATAKVTKGEVKQLVNPETTAAAALAAKAQHSKPIRQPIVQTPHVPDRPPSQLSASASSHPNNYLHDKQPGSFDPSSLSRFFQPRQNARATSSVAATSVPAAASQNVDAQPKPKPAQDNDLESESGTSSSSSSSSESGSESDSGSDDGSASGSGDNSSTSSESESESDSGSEVDEKNNKNEKIDSESIKNNESKDDIPSKDENSSNDNREISKTDEEGHDSKRRKVSEDINEGITEVNVSLEEKL 2FC02DFC0DFFF503 2FC02DFC0DFFF503 rl11_yeast_gene 60S ribosomal protein L11-A gene gene gene yeast Saccharomyces cerevisiae Baker's yeast rrp7_yeast Ribosomal RNA-processing protein 7 RRP7 YCL184 YCL31C YCL031C protein protein yeast Saccharomyces cerevisiae Baker's yeast MGIEDISAMKNGFIVVPFKLPDHKALPKSQEASLHFMFAKRHQSSNSNESDCLFLVNLPLLSNIEHMKKFVGQLCGKYDTVSHVEELLYNDEFGLHEVDLSALTSDLMSSTDVNEKRYTPRNTALLKFVDAASINNCWNALKKYSNLHAKHPNELFEWTYTTPSFTTFVNFYKPLDIDYLKEDIHTHMAIFEQREAQAQEDVQSSIVDEDGFTLVVGKNTKSLNSIRKKILNKNPLSKHENKAKPISNIDKKAKKDFYRFQVRERKKQEINQLLSKFKEDQERIKVMKAKRKFNPYT 768F43B0057788F2 768F43B0057788F2 snru3a yeast small nuclear RNA U3a Yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast GUCGACGUACUUCAGUAUGUAAUAUACCCCAAACAUUUUACCCACAAAAAACCAGGAUUUGAAAACUAUAGCAUCUAAAAGUCUUAGGUACUAGAGUUUUCAUUUCGGAGCAGGCUUUUUGAAAAAUUUAAUUCAACCAUUGCAGCAGCUUUUGACUAACACAUUCUACAGUAGGAUCAUUUCUAUAGGAAUCGUCACUCUUUGACUCUUCAAAAGAGCCACUGAAUCCAACUUGGUUGAUGAGUCCCAUAACCUUUGUACCCCAGAGUGAGAAACCGAAAUUGAAUCUAAAUUAGCUUGGUCCGCAAUCCUUAGCGGUUCGGCCAUCUAUAAUUUUGAAUAAAAAUUUUGCUUUGCCGUUGCAUUUGUAGUUUUUUCCUUUGGAAGUAAUUACAAUAUUUUAUGGCGCGAUGAUCUUGACCCAUCCUAUGUACUUCUUUUUUGAAGGGAUAGGGCUCUAUGGGUGGGUACAAAUGGCAGUCUGACAAGU utp22_yeast U3 small nucleolar RNA-associated protein 22 UTP22 U three protein 22 YGR090W protein protein yeast Saccharomyces cerevisiae Baker's yeast MATSVKRKASETSDQNIVKVQKKHSTQDSTTDNGSKENDHSSQAINERTVPEQENDESDTSPESNEVATNTAATRHNGKVTATESYDIHIARETAELFKSNIFKLQIDELLEQVKLKQKHVLKVEKFLHKLYDILQEIPDWEEKSLAEVDSFFKNKIVSVPFVDPKPIPQNTNYKFNYKKPDISLIGSFALKAGIYQPNGSSIDTLLTMPKELFEKKDFLNFRCLHKRSVYLAYLTHHLLILLKKDKLDSFLQLEYSYFDNDPLLPILRISCSKPTGDSLSDYNFYKTRFSINLLIGFPYKVFEPKKLLPNRNCIRIAQESKEQSLPATPLYNFSVLSSSTHENYLKYLYKTKKQTESFVEATVLGRLWLQQRGFSSNMSHSGSLGGFGTFEFTILMAALLNGGGINSNKILLHGFSSYQLFKGVIKYLATMDLCHDGHLQFHSNPENSSSSPASKYIDEGFQTPTLFDKSTKVNILTKMTVSSYQILKEYAGETLRMLNNVVQDQFSNIFLTNISRFDNLKYDLCYDVQLPLGKYNNLETSLAATFGSMERVKFITLENFLAHKITNVARYALGDRIKYIQIEMVGQKSDFPITKRKVYSNTGGNHFNFDFVRVKLIVNPSECDKLVTKGPAHSETMSTEAAVFKNFWGIKSSLRRFKDGSITHCCVWSTSSSEPIISSIVNFALQKHVSKKAQISNETIKKFHNFLPLPNLPSSAKTSVLNLSSFFNLKKSFDDLYKIIFQMKLPLSVKSILPVGSAFRYTSLCQPVPFAYSDPDFFQDVILEFETSPKWPDEITSLEKAKTAFLLKIQEELSANSSTYRSFFSRDESIPYNLEIVTLNILTPEGYGFKFRVLTERDEILYLRAIANARNELKPELEATFLKFTAKYLASVRHTRTLENISHSYQFYSPVVRLFKRWLDTHLLLGHITDELAELIAIKPFVDPAPYFIPGSLENGFLKVLKFISQWNWKDDPLILDLVKPEDDIRDTFETSIGAGSELDSKTMKKLSERLTLAQYKGIQMNFTNLRNSDPNGTHLQFFVASKNDPSGILYSSGIPLPIATRLTALAKVAVNLLQTHGLNQQTINLLFTPGLKDYDFVVDLRTPIGLKSSCGILSATEFKNITNDQAPSNFPENLNDLSEKMDPTYQLVKYLNLKYKNSLILSSRKYIGVNGGEKGDKNVITGLIKPLFKGAHKFRVNLDCNVKPVDDENVILNKEAIFHEIAAFGNDMVINFETD 9A2B5C885493D7D3 9A2B5C885493D7D3 rl30_yeast_gene 60S ribosomal protein L30 gene gene gene yeast Saccharomyces cerevisiae Baker's yeast ifh1_yeast Protein IFH1 RRP3 L8083.9 YLR223C IFH1 Ribosomal RNA-processing protein 3 protein protein yeast Saccharomyces cerevisiae Baker's yeast MAGKKSPRKSTINHSTHSGKLPANIKRLIKKGESDTKSRQSPPTLSTTRPRRFSLIYSSESSLSDVSDSDKNKSTNPHKIKRKAKNISNNSQGKKSKLIQRQIDNDDEGTESSDYQAVTDGEESENEEEESEEEEEDDDEDDDDDDDDGSDSDSDSETSSDDENIDFVKLTAQRKKRAMKALSAMNTNSNTLYSSRENSNKNKSVKLSPKKENEEEQKEEKEKEKEEQQKQQESNKKEVNGSGTTTTQQALSFKFKKEDDGISFGNGNEGYNEDIGEEVLDLKNKENNGNEEDKLDSKVMLGNNDELRFPNISESDESEYDIDQDAYFDVINNEDSHGEIGTDLETGEDDLPILEEEEQNIVSELQNDDELSFDGSIHEEGSDPVEDAENKFLQNEYNQENGYDEEDDEEDEIMSDFDMPFYEDPKFANLYYYGDGSEPKLSLSTSLPLMLNDEKLSKLKKKEAKKREQEERKQRRKLYKKTQKPSTRTTSNVDNDEYIFNVFFQSDDENSGHKSKKGRHKSGKSHIEHKNKGSNLIKSNDDLEPSTHSTVLNSGKYDSSDDEYDNILLDVAHMPSDDECSESETSHDADTDEELRALDSDSLDIGTELDDDYEDDDDDSSVTNVFIDIDDLDPDSFYFHYDSDGSSSLISSNSDKENSDGSKDCKHDLLETVVYVDDESTDEDDNLPPPSSRSKNIGSKAKEIVSSNVVGLRPPKLGTWETDNKPFSIIDGLSTKSLYALIQEHQQLREQHQRAQTPDVKREGSSNGNNGDELTLNELLNMSELEDDSPSHTDDMENNYNDAINSKSTNGHAADWYEVPKVPLSAFRNKGINAYEEDEYMIPANSNRKVPIGYIGNERTRKKIDKMKELQRKKTEKKRQLKKKKKLLKIRKQRQKAIKEQETMNLQLGINGHEIIGNNNSHSDINTGTDFTTNENTPMNELPSHAPEDASLIPHNSDLAVDSNTRKNSTKSVGLDEIHEILGKDENDLLSVGDINGYDAQEGHVIEDTDADILASLTAPVQFDNTLSHENSNSMWRRRQSMVEAAAENLRFTKNGLFSESALADIEGIMGNDVNHSFEFNDVLQ BE1C7DEF06213FE0 csk2c_yeast Casein kinase II subunit beta' CKB2 OR26.32 YOR039W protein protein yeast Saccharomyces cerevisiae Baker's yeast MGSRSENVGTVTREGSRVEQDDVLMDDDSDSSEYVDMWIDLFLGRKGHEYFCDVDPEYITDRFNLMNLQKTVSKFSYVVQYIVDDLDDSILENMTHARLEQLESDSRKLYGLIHARYIITIKGLQKMYAKYKEADFGRCPRVYCNLQQLLPVGLHDIPGIDCVKLYCPSCEDLYIPKSSRHSSIDGAYFGTSFPGMFLQAFPDMVPKHPTKRYVPKIFGFELHKQAQLTRWQELQRLKLVEKLESKDVDLTKSGGFKT D6060CB3D70B19A4 D6060CB3D70B19A4 rap1_yeast DNA-binding protein RAP1 RAP1 GRF1 TUF1 YNL216W N1310 SBF-E Repressor/activator site-binding protein TUF protein protein yeast Saccharomyces cerevisiae Baker's yeast MSSPDDFETAPAEYVDALDPSMVVVDSGSAAVTAPSDSAAEVKANQNEENTGATAAETSEKVDQTEVEKKDDDDTTEVGVTTTTPSIADTAATANIASTSGASVTEPTTDDTAADEKKEQVSGPPLSNMKFYLNRDADAHDSLNDIDQLARLIRANGGEVLDSKPRESKENVFIVSPYNHTNLPTVTPTYIKACCQSNSLLNMENYLVPYDNFREVVDSRLQEESHSNGVDNSNSNSDNKDSIRPKTEIISTNTNGATEDSTSEKVMVDAEQQARLQEQAQLLRQHVSSTASITSGGHNDLVQIEQPQKDTSNNNNSNVNDEDNDLLTQDNNPQTADEGNASFQAQRSMISRGALPSHNKASFTDEEDEFILDVVRKNPTRRTTHTLYDEISHYVPNHTGNSIRHRFRVYLSKRLEYVYEVDKFGKLVRDDDGNLIKTKVLPPSIKRKFSADEDYTLAIAVKKQFYRDLFQIDPDTGRSLITDEDTPTAIARRNMTMDPNHVPGSEPNFAAYRTQSRRGPIAREFFKHFAEEHAAHTENAWRDRFRKFLLAYGIDDYISYYEAEKAQNREPEPMKNLTNRPKRPGVPTPGNYNSAAKRARNYSSQRNVQPTANAASANAAAAAAAAASNSYAIPENELLDEDTMNFISSLKNDLSNISNSLPFEYPHEIAEAIRSDFSNEDIYDNIDPDTISFPPKIATTDLFLPLFFHFGSTRQFMDKLHEVISGDYEPSQAEKLVQDLCDETGIRKNFSTSILTCLSGDLMVFPRYFLNMFKDNVNPPPNVPGIWTHDDDESLKSNDQEQIRKLVKKHGTGRMEMRKRFFEKDLL 67C4AFB03B3C0713 67C4AFB03B3C0713 csk21_yeast Casein kinase II subunit alpha YIL035C CKA1 protein protein yeast Saccharomyces cerevisiae Baker's yeast MKCRVWSEARVYTNINKQRTEEYWDYENTVIDWSTNTKDYEIENKVGRGKYSEVFQGVKLDSKVKIVIKMLKPVKKKKIKREIKILTDLSNEKVPPTTLPFQKDQYYTNQKEDVLKFIRPYIFDQPHNGHANIIHLFDIIKDPISKTPALVFEYVDNVDFRILYPKLTDLEIRFYMFELLKALDYCHSMGIMHRDVKPHNVMIDHKNKKLRLIDWGLAEFYHVNMEYNVRVASRFFKGPELLVDYRMYDYSLDLWSFGTMLASMIFKREPFFHGTSNTDQLVKIVKVLGTSDFEKYLLKYEITLPREFYDMDQYIRKPWHRFINDGNKHLSGNDEIIDLIDNLLRYDHQERLTAKEAMGHPWFAPIREQIEK 6A1A7F1BF47250C9 6A1A7F1BF47250C9 rap1-fhl1-1 3 7 unspecified role unspecified role prey prey c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain P39521:p.Ser325Arg mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain S R Wed May 02 17:42:02 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser325arg' Tue Jun 30 19:04:35 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser325Arg' 13 unspecified role unspecified role prey prey c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 15 unspecified role unspecified role bait bait association association Fig. 1A, 1B, 2C, 6D Rap1 association with Fhl1 and Ifh1 is DNA-independent. ifh1-rl30_yeast_gene-1 4 12 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range association association Fig. 9 ifh1-fhl1-2 1 7 unspecified role unspecified role prey prey c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 13 unspecified role unspecified role bait bait c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 2B, 5A The interaction was observed following pre-purification of the complex by density gradient centrifugation. rap1-fhl1-2 5 9 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range 11 unspecified role unspecified role prey prey 16 unspecified role unspecified role prey prey association association Fig. 3C Rap1 association with Fhl1 and Ifh1 is DNA-independent. utp22-fhl1-1 2 7 unspecified role unspecified role prey prey c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 13 unspecified role unspecified role prey prey c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 11 unspecified role unspecified role bait bait c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range association association Fig. 5A, 6B fhl1-rrp7-1 1 7 unspecified role unspecified role bait bait c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 9 unspecified role unspecified role prey prey c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 6A The interaction was observed following pre-purification of the complex by density gradient centrifugation. fhl1-ckb2-1 1 7 unspecified role unspecified role bait bait c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 14 unspecified role unspecified role prey prey c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 6A fhl1-ckb2-2 1 13 unspecified role unspecified role prey prey c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 7 unspecified role unspecified role prey prey c-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range 14 unspecified role unspecified role bait bait c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range association association Fig. 5C, 6C ifh1-rl11_yeast_gene-1 4 8 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range association association Fig.9 ifh1-rs6a_yeast_gene-1 4 6 unspecified role unspecified role prey prey 13 unspecified role unspecified role bait bait c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range association association Fig. 9 ifh1-utp22-1 1 11 unspecified role unspecified role prey prey c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range 13 unspecified role unspecified role bait bait c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 2B The interaction was observed following pre-purification of the complex by density gradient centrifugation. ifh1-utp22-2 1 10 northern blot northern blot northen anti tag western anti tag western blot anti tag western unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range 13 unspecified role unspecified role prey prey c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 4B The interaction was observed following pre-purification of the complex by density gradient centrifugation. utp22-fhl1-2 1 7 unspecified role unspecified role prey prey c-terminal tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range 11 unspecified role unspecified role bait bait c-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range 13 unspecified role unspecified role prey prey c-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 5A The interaction was observed following pre-purification of the complex by density gradient centrifugation.