IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The Saccharomyces cerevisiae TAN1 gene is required for N4-acetylcytidine formation in tRNA. The Saccharomyces cerevisiae TAN1 gene is required for N4-acetylcytidine formation in tRNA. RNA (New York, N.Y.) 2004 imex curation Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se Anders.Bystrom@ molbiol.umu.se Accepted 2016-APR-08 AT 10:49 BST AT 10:49 BST by MGT RNA (New York, N.Y.) 2004 imex curation The Saccharomyces cerevisiae TAN1 gene is required for N4-acetylcytidine formation in tRNA. The Saccharomyces cerevisiae TAN1 gene is required for N4-acetylcytidine formation in tRNA. RNA (New York, N.Y.) 2004 imex curation Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se 22-Jun-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Johansson MJ., Byström AS. Anders.Bystrom@molbiol.umu.se Anders.Bystrom@ molbiol.umu.se Accepted 2016-APR-08 AT 10:49 BST AT 10:49 BST by MGT RNA (New York, N.Y.) 2004 imex curation tan1_yeast tRNA acetyltransferase TAN1 TAN1 YGL232W protein protein yeast Saccharomyces cerevisiae Baker's yeast MGEKRNRNGKDANSQNRKKFKVSSGFLDPGTSGIYATCSRRHERQAAQELQLLFEEKFQELYGDIKEGEDESENDEKKDLSIEDQIKKELQELKGEETGKDLSSGETKKKDPLAFIDLNCECVTFCKTRKPIVPEEFVLSIMKDLADPKNMVKRTRYVQKLTPITYSCNAKMEQLIKLANLVIGPHFHDPSNVKKNYKFAVEVTRRNFNTIERMDIINQVVKLVNKEGSEFNHTVDLKNYDKLILVECFKSNIGMCVVDGDYKTKYRKYNVQQLYESKFRKDEDKSVKQ 0E1C8C55E70CEB28 trna ser cga tRNA serine CGA trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast GGCACUAUGGCCGAGUGGUUAAGGCGAGAGACUCGAAAUCUCUUGGGCUCUGCCCGCGCUGGUUCAAAUCCUGCUGGUGUCG trna glu uuc trna glu UUC trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna yeast Saccharomyces cerevisiae Baker's yeast UCCGAUAUAGUGUAACGGCUAUCACAUCACGCUUUCACCGUGGAGACCGGGGUUCGACUCCCCGUAUCGGAG tan1-1 2 3 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction Fig 4B trna ser cga-tan1-1 1 3 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction Fig 4B trna glu uuc-tan1-1 1 3 unspecified role unspecified role prey prey tag gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction Fig 4C