IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-hela_s3 Homo sapiens HeLa-S3 cervix carcinoma cell line hela_s3 HeLa-S3 cervix carcinoma cell line Human cervix carcinoma cell line is a subclone of its parent HELA (DSM ACC 57) derived in 1955 confirmed as human with IEF of AST, MDH anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. Source of WRAP53 (TCAB1) inferred from sequence length sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-lymphoblast Homo sapiens, lymphoblast lymphoblast Transformed lymphocytes; Blast cell; Lymphoblastoid anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. Source of WRAP53 (TCAB1) inferred from sequence length sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-hela_s3 Homo sapiens HeLa-S3 cervix carcinoma cell line hela_s3 HeLa-S3 cervix carcinoma cell line Human cervix carcinoma cell line is a subclone of its parent HELA (DSM ACC 57) derived in 1955 confirmed as human with IEF of AST, MDH anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-hela_s3 Homo sapiens HeLa-S3 cervix carcinoma cell line hela_s3 HeLa-S3 cervix carcinoma cell line Human cervix carcinoma cell line is a subclone of its parent HELA (DSM ACC 57) derived in 1955 confirmed as human with IEF of AST, MDH anti tag coip anti tag coimmunoprecipitation anti tag coip sequence tag sequence tag identification sequence tag Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. Source of WRAP53 (TCAB1) inferred from sequence length sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Proteostatic control of telomerase function through TRiC-mediated folding of TCAB1. Cell (0092-8674) 2014 imex curation Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. sartandi@stanford.edu 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro anti tag coip anti tag coimmunoprecipitation anti tag coip northern blot northern blot northen Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E., Freund A., Zhong F.L., Venteicher A.S., Meng Z., Veenstra T.D., Frydman J., Artandi S.E. Source of WRAP53 (TCAB1) inferred from sequence length sartandi@stanford.edu Accepted 2015-AUG-12 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation imex curation I'd make a separate interaction if CCT3 had been knocked out and the complex happily formed without it, but I think its better to merge the 2 when its just a case of them not looking for it. tcpb_human T-complex protein 1 subunit beta CCT2 99D8.1 CCTB CCT-beta protein protein human Homo sapiens Human MASLSLAPVNIFKAGADEERAETARLTSFIGAIAIGDLVKSTLGPKGMDKILLSSGRDASLMVTNDGATILKNIGVDNPAAKVLVDMSRVQDDEVGDGTTSVTVLAAELLREAESLIAKKIHPQTIIAGWREATKAAREALLSSAVDHGSDEVKFRQDLMNIAGTTLSSKLLTHHKDHFTKLAVEAVLRLKGSGNLEAIHIIKKLGGSLADSYLDEGFLLDKKIGVNQPKRIENAKILIANTGMDTDKIKIFGSRVRVDSTAKVAEIEHAEKEKMKEKVERILKHGINCFINRQLIYNYPEQLFGAAGVMAIEHADFAGVERLALVTGGEIASTFDHPELVKLGSCKLIEEVMIGEDKLIHFSGVALGEACTIVLRGATQQILDEAERSLHDALCVLAQTVKDSRTVYGGGCSEMLMAHAVTQLANRTPGKEAVAMESYAKALRMLPTIIADNAGYDSADLVAQLRAAHSEGNTTAGLDMREGTIGDMAILGITESFQVKRQVLLSAAEAAEVILRVDNIIKAAPRKRVPDHHPC DIP protein P78371 original sequence version: 101 DIP protein P78371 original sequence version: 107 57F9E1720D84A31F tcpz_rabit T-complex protein 1 subunit zeta CCT6 CCT-zeta protein protein rabit Oryctolagus cuniculus (Rabbit) Rabbit MAAVKTLNPKAEVARAQAALAVNISAARGLQDVLRTNLGPKGTMKMLVSGAGDIKLTKDGNVLLHEMQIQHPTASLIAKVATAQDDITGDGTTSNVLIIGELLKQADLYISEGLHPRIITEGFEAAKEKALQVLEQIKVSREMDRETLIDVARTSLRTKVHAELADVLTEAVVDSILAIKKQDEPIDLFMVEIMEMKHKSETDTSLIRGLVLDHGARHPDMKKRVEDAYILTCNVSLEYEKTEVNSGFFYKSAEEREKLVKAERKFIEDRVKKIVELKKKVCGDSDKGFVVINQKGIDPFSLDALAKEGIVALRRAKRRNMERLTLACGGVPLNSLDDLNPDCLGHAGLVYEYTLGEEKFTFIEKCNNPRSVTLLVKGPNKHTLTQIKDAIRDGLRAVKNAIDDGCVVPGAGAVEVAMAEALIKYKSSVKGRAQLGVQAFADALLIIPKVLAQNSGFDLQETLVKIRTEHSESGQLVGVDLNTGEPMVAAEVGIWDNYCVKKQLLHSCTVIATNILLVDEIMRAGMSSLKG 2A5007DA986A5338 tcpd_human T-complex protein 1 subunit delta CCT4 CCTD SRB CCT-delta Stimulator of TAR RNA-binding protein protein human Homo sapiens Human MPENVAPRSGATAGAAGGRGKGAYQDRDKPAQIRFSNISAAKAVADAIRTSLGPKGMDKMIQDGKGDVTITNDGATILKQMQVLHPAARMLVELSKAQDIEAGDGTTSVVIIAGSLLDSCTKLLQKGIHPTIISESFQKALEKGIEILTDMSRPVELSDRETLLNSATTSLNSKVVSQYSSLLSPMSVNAVMKVIDPATATSVDLRDIKIVKKLGGTIDDCELVEGLVLTQKVSNSGITRVEKAKIGLIQFCLSAPKTDMDNQIVVSDYAQMDRVLREERAYILNLVKQIKKTGCNVLLIQKSILRDALSDLALHFLNKMKIMVIKDIEREDIEFICKTIGTKPVAHIDQFTADMLGSAELAEEVNLNGSGKLLKITGCASPGKTVTIVVRGSNKLVIEEAERSIHDALCVIRCLVKKRALIAGGGAPEIELALRLTEYSRTLSGMESYCVRAFADAMEVIPSTLAENAGLNPISTVTELRNRHAQGEKTAGINVRKGGISNILEELVVQPLLVSVSALTLATETVRSILKIDDVVNTR DIP protein P50991 original sequence version: 100 39913C0D0735180D tcpg_human T-complex protein 1 subunit gamma CCT3 CCTG TRIC5 CCT-gamma hTRiC5 protein protein human Homo sapiens Human MMGHRPVLVLSQNTKRESGRKVQSGNINAAKTIADIIRTCLGPKSMMKMLLDPMGGIVMTNDGNAILREIQVQHPAAKSMIEISRTQDEEVGDGTTSVIILAGEMLSVAEHFLEQQMHPTVVISAYRKALDDMISTLKKISIPVDISDSDMMLNIINSSITTKAISRWSSLACNIALDAVKMVQFEENGRKEIDIKKYARVEKIPGGIIEDSCVLRGVMINKDVTHPRMRRYIKNPRIVLLDSSLEYKKGESQTDIEITREEDFTRILQMEEEYIQQLCEDIIQLKPDVVITEKGISDLAQHYLMRANITAIRRVRKTDNNRIARACGARIVSRPEELREDDVGTGAGLLEIKKIGDEYFTFITDCKDPKACTILLRGASKEILSEVERNLQDAMQVCRNVLLDPQLVPGGGASEMAVAHALTEKSKAMTGVEQWPYRAVAQALEVIPRTLIQNCGASTIRLLTSLRAKHTQENCETWGVNGETGTLVDMKELGIWEPLAVKLQTYKTAVETAVLLLRIDDIVSGHKKKGDDQSRQGGAPDAGQE DIP protein P49368 original sequence version: 109 DIP protein P49368 original sequence version: 147 DIP protein P49368 original sequence version: 117 0A528762EF24F36B dkc1_human H/ACA ribonucleoprotein complex subunit DKC1 Dyskerin Nucleolar protein family A member 4 snoRNP protein DKC1 Nopp140-associated protein of 57 kDa Nucleolar protein NAP57 CBF5 homolog DKC1 NOLA4 protein protein human Homo sapiens Human MADAEVIILPKKHKKKKERKSLPEEDVAEIQHAEEFLIKPESKVAKLDTSQWPLLLKNFDKLNVRTTHYTPLACGSNPLKREIGDYIRTGFINLDKPSNPSSHEVVAWIRRILRVEKTGHSGTLDPKVTGCLIVCIERATRLVKSQQSAGKEYVGIVRLHNAIEGGTQLSRALETLTGALFQRPPLIAAVKRQLRVRTIYESKMIEYDPERRLGIFWVSCEAGTYIRTLCVHLGLLLGVGGQMQELRRVRSGVMSEKDHMVTMHDVLDAQWLYDNHKDESYLRRVVYPLEKLLTSHKRLVMKDSAVNAICYGAKIMLPGVLRYEDGIEVNQEIVVITTKGEAICMAIALMTTAVISTCDHGIVAKIKRVIMERDTYPRKWGLGPKASQKKLMIKQGLLDKHGKPTDSTPATWKQEYVDYSESAKKEVVAEVVKAPQVVAEAAKTAKRKRESESESDETPPAAPQLIKKEKKKSKKDKKAKAGLESGAEPGDGDSDTTKKKKKKKKAKEVELVSE DIP protein O60832 original sequence version: 148 DIP protein O60832 original sequence version: 167 12474DBEEFEB471C tcph_human T-complex protein 1 subunit eta CCT7 CCTH NIP7-1 CCT-eta HIV-1 Nef-interacting protein protein protein human Homo sapiens Human MMPTPVILLKEGTDSSQGIPQLVSNISACQVIAEAVRTTLGPRGMDKLIVDGRGKATISNDGATILKLLDVVHPAAKTLVDIAKSQDAEVGDGTTSVTLLAAEFLKQVKPYVEEGLHPQIIIRAFRTATQLAVNKIKEIAVTVKKADKVEQRKLLEKCAMTALSSKLISQQKAFFAKMVVDAVMMLDDLLQLKMIGIKKVQGGALEDSQLVAGVAFKKTFSYAGFEMQPKKYHNPKIALLNVELELKAEKDNAEIRVHTVEDYQAIVDAEWNILYDKLEKIHHSGAKVVLSKLPIGDVATQYFADRDMFCAGRVPEEDLKRTMMACGGSIQTSVNALSADVLGRCQVFEETQIGGERYNFFTGCPKAKTCTFILRGGAEQFMEETERSLHDAIMIVRRAIKNDSVVAGGGAIEMELSKYLRDYSRTIPGKQQLLIGAYAKALEIIPRQLCDNAGFDATNILNKLRARHAQGGTWYGVDINNEDIADNFEAFVWEPAMVRINALTAASEAACLIVSVDETIKNPRSTVDAPTAAGRGRGRGRPH DIP protein Q99832 original sequence version: 112 9F1E33FA80E6238E tcpq_human T-complex protein 1 subunit theta CCT8 CCTQ KIAA0002 CCT-theta Renal carcinoma antigen NY-REN-15 C21orf112 Chaperonin containing T-complex polypeptide 1 subunit 8 protein protein human Homo sapiens Human MALHVPKAPGFAQMLKEGAKHFSGLEEAVYRNIQACKELAQTTRTAYGPNGMNKMVINHLEKLFVTNDAATILRELEVQHPAAKMIVMASHMQEQEVGDGTNFVLVFAGALLELAEELLRIGLSVSEVIEGYEIACRKAHEILPNLVCCSAKNLRDIDEVSSLLRTSIMSKQYGNEVFLAKLIAQACVSIFPDSGHFNVDNIRVCKILGSGISSSSVLHGMVFKKETEGDVTSVKDAKIAVYSCPFDGMITETKGTVLIKTAEELMNFSKGEENLMDAQVKAIADTGANVVVTGGKVADMALHYANKYNIMLVRLNSKWDLRRLCKTVGATALPRLTPPVLEEMGHCDSVYLSEVGDTQVVVFKHEKEDGAISTIVLRGSTDNLMDDIERAVDDGVNTFKVLTRDKRLVPGGGATEIELAKQITSYGETCPGLEQYAIKKFAEAFEAIPRALAENSGVKANEVISKLYAVHQEGNKNVGLDIEAEVPAVKDMLEAGILDTYLGKYWAIKLATNAAVTVLRVDQIIMAKPAGGPKPPSGKKDWDDDQND DIP protein P50990 original sequence version: 110 566A6622BC2D15E9 tcpz_human T-complex protein 1 subunit zeta CCT6A CCT6 CCTZ CCT-zeta-1 Tcp20 HTR3 Acute morphine dependence-related protein 2 protein protein human Homo sapiens Human MAAVKTLNPKAEVARAQAALAVNISAARGLQDVLRTNLGPKGTMKMLVSGAGDIKLTKDGNVLLHEMQIQHPTASLIAKVATAQDDITGDGTTSNVLIIGELLKQADLYISEGLHPRIITEGFEAAKEKALQFLEEVKVSREMDRETLIDVARTSLRTKVHAELADVLTEAVVDSILAIKKQDEPIDLFMIEIMEMKHKSETDTSLIRGLVLDHGARHPDMKKRVEDAYILTCNVSLEYEKTEVNSGFFYKSAEEREKLVKAERKFIEDRVKKIIELKRKVCGDSDKGFVVINQKGIDPFSLDALSKEGIVALRRAKRRNMERLTLACGGVALNSFDDLSPDCLGHAGLVYEYTLGEEKFTFIEKCNNPRSVTLLIKGPNKHTLTQIKDAVRDGLRAVKNAIDDGCVVPGAGAVEVAMAEALIKHKPSVKGRAQLGVQAFADALLIIPKVLAQNSGFDLQETLVKIQAEHSESGQLVGVDLNTGEPMVAAEVGVWDNYCVKKQLLHSCTVIATNILLVDEIMRAGMSSLKG DIP protein P40227 original sequence version: 109 43ABCF548CC82B81 tcpe_human T-complex protein 1 subunit epsilon CCT5 CCTE KIAA0098 CCT-epsilon protein protein human Homo sapiens Human MASMGTLAFDEYGRPFLIIKDQDRKSRLMGLEALKSHIMAAKAVANTMRTSLGPNGLDKMMVDKDGDVTVTNDGATILSMMDVDHQIAKLMVELSKSQDDEIGDGTTGVVVLAGALLEEAEQLLDRGIHPIRIADGYEQAARVAIEHLDKISDSVLVDIKDTEPLIQTAKTTLGSKVVNSCHRQMAEIAVNAVLTVADMERRDVDFELIKVEGKVGGRLEDTKLIKGVIVDKDFSHPQMPKKVEDAKIAILTCPFEPPKPKTKHKLDVTSVEDYKALQKYEKEKFEEMIQQIKETGANLAICQWGFDDEANHLLLQNNLPAVRWVGGPEIELIAIATGGRIVPRFSELTAEKLGFAGLVQEISFGTTKDKMLVIEQCKNSRAVTIFIRGGNKMIIEEAKRSLHDALCVIRNLIRDNRVVYGGGAAEISCALAVSQEADKCPTLEQYAMRAFADALEVIPMALSENSGMNPIQTMTEVRARQVKEMNPALGIDCLHKGTNDMKQQHVIETLIGKKQQISLATQMVRMILKIDDIRKPGESEE DIP protein P48643 original sequence version: 108 164168BB80EF022A tcab1_human Telomerase Cajal body protein 1 TCAB1 WDR79 WD repeat-containing protein 79 WRAP53 WD40 repeat-containing protein antisense to TP53 gene protein protein human Homo sapiens Human MKTLETQPLAPDCCPSDQDPAPAHPSPHASPMNKNADSELMPPPPERGDPPRLSPDPVAGSAVSQELREGDPVSLSTPLETEFGSPSELSPRIEEQELSENTSLPAEEANGSLSEEEANGPELGSGKAMEDTSGEPAAEDEGDTAWNYSFSQLPRFLSGSWSEFSTQPENFLKGCKWAPDGSCILTNSADNILRIYNLPPELYHEGEQVEYAEMVPVLRMVEGDTIYDYCWYSLMSSAQPDTSYVASSSRENPIHIWDAFTGELRASFRAYNHLDELTAAHSLCFSPDGSQLFCGFNRTVRVFSTARPGRDCEVRATFAKKQGQSGIISCIAFSPAQPLYACGSYGRSLGLYAWDDGSPLALLGGHQGGITHLCFHPDGNRFFSGARKDAELLCWDLRQSGYPLWSLGREVTTNQRIYFDLDPTGQFLVSGSTSGAVSVWDTDGPGNDGKPEPVLSFLPQKDCTNGVSLHPSLPLLATASGQRVFPEPTESGDEGEELGLPLLSTRHVHLECRLQLWWCGGAPDSSIPDDHQGEKGQGGTEGGVGELI DIP protein Q9BUR4 original sequence version: 79 4687517268A813B5 terc_human_rna Human telomerase RNA rna ribonucleic acid RNA rna human Homo sapiens Human GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC tcpa_human T-complex protein 1 subunit alpha CCTA TCP1 CCT1 CCT-alpha protein protein human Homo sapiens Human MEGPLSVFGDRSTGETIRSQNVMAAASIANIVKSSLGPVGLDKMLVDDIGDVTITNDGATILKLLEVEHPAAKVLCELADLQDKEVGDGTTSVVIIAAELLKNADELVKQKIHPTSVISGYRLACKEAVRYINENLIVNTDELGRDCLINAAKTSMSSKIIGINGDFFANMVVDAVLAIKYTDIRGQPRYPVNSVNILKAHGRSQMESMLISGYALNCVVGSQGMPKRIVNAKIACLDFSLQKTKMKLGVQVVITDPEKLDQIRQRESDITKERIQKILATGANVILTTGGIDDMCLKYFVEAGAMAVRRVLKRDLKRIAKASGATILSTLANLEGEETFEAAMLGQAEEVVQERICDDELILIKNTKARTSASIILRGANDFMCDEMERSLHDALCVVKRVLESKSVVPGGGAVEAALSIYLENYATSMGSREQLAIAEFARSLLVIPNTLAVNAAQDSTDLVAKLRAFHNEAQVNPERKNLKWIGLDLSNGKPRDNKQAGVFEPTIVKVKSLKFATEAAITILRIDDLIKLHPESKDDKHGSYEDAVHSGALND DIP protein P17987 original sequence version: 114 DIP protein P17987 original sequence version: 123 486ECA836EA258A1 wrap53-cct2-1 5 11 unspecified role unspecified role prey prey 13 unspecified role unspecified role prey prey 12 unspecified role unspecified role prey prey 14 unspecified role unspecified role prey prey 15 unspecified role unspecified role prey prey 9 unspecified role unspecified role prey prey 10 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey 18 unspecified role unspecified role prey prey 16 unspecified role unspecified role bait bait n-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association Fig. 4C wrap53-cct2-2 4 10 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey 18 unspecified role unspecified role prey prey 16 unspecified role unspecified role bait bait association association Fig. 4D, 6H wrap53-cct2-3 3 17 northern blot northern blot northen western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey in vitro In vitro 16 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role prey prey association association Fig. 4E, 5F wrap53-terc_human_rna-1 6 17 unspecified role unspecified role prey prey m1 mutation mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G C m2 mutation mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G X in vitro In vitro 16 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain Q9BUR4:p.Phe164Leu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain F L Wed May 02 20:20:29 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe164leu' Tue Jun 30 18:14:02 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe164Leu' Q9BUR4:p.His376Tyr mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain H Y Wed May 02 18:46:53 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his376tyr' Tue Jun 30 17:06:43 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His376Tyr' Q9BUR4:p.Gly435Arg mutation mutation certain certain sequence position certain certain certain sequence position certain G R Wed May 02 17:21:38 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly435arg' Tue Jun 30 18:13:06 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly435Arg' Q9BUR4:p.Arg398Trp mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain R W Wed May 02 16:50:11 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg398trp' Tue Jun 30 19:33:20 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg398Trp' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes physical association physical association Fig. 4E, 5F, 6F, Supp. Fig. 3F TCAB1 is an obligate TRiC substrate, requiring TRiC for folding and TERC binding wrap53-cct6-1 3 16 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role prey prey physical association physical association Fig. 4E wrap53-cct2-4 1 14 unspecified role unspecified role prey prey 10 unspecified role unspecified role prey prey 16 unspecified role unspecified role bait bait n-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain Q9BUR4:p.Phe164Leu mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain F L Wed May 02 19:10:00 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe164leu' Tue Jun 30 17:42:48 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe164Leu' Q9BUR4:p.His376Tyr mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain H Y Wed May 02 19:18:34 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his376tyr' Tue Jun 30 16:25:51 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His376Tyr' Q9BUR4:p.Gly435Arg mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain G R Wed May 02 16:48:14 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly435arg' Tue Jun 30 17:56:08 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly435Arg' Q9BUR4:p.Arg398Trp mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain R W Wed May 02 18:03:30 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg398trp' Tue Jun 30 19:21:50 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg398Trp' association association Fig. 6G, Supp. Fig. 3D wrap53-cct2-5 2 10 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey 18 unspecified role unspecified role prey prey 16 unspecified role unspecified role bait bait n-terminal ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range Q9BUR4:p.[Phe164Leu;Arg398Trp] mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain R W certain certain sequence position certain certain certain sequence position certain F L Fri Jul 22 11:10:10 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'arg398trp,phe164leu' Wed May 02 16:59:32 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe164leu,arg398trp' Tue Jun 30 19:19:18 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Phe164Leu;Arg398Trp]' Q9BUR4:p.[His376Tyr;Gly435Arg] mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain H Y certain certain sequence position certain certain certain sequence position certain G R Wed May 02 19:24:04 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his376tyr,gly435arg' Tue Jun 30 19:42:28 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[His376Tyr;Gly435Arg]' association association Fig. 6H