IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Structure and assembly of the SF3a splicing factor complex of U2 snRNP. Structure and assembly of the SF3a splicing factor complex of U2 snRNP. The EMBO journal 2012 imex curation Lin PC., Xu RM., Lin PC., Xu RM. rmxu@ibp.ac.cn 11-Apr-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction sequence tag sequence tag identification sequence tag Lin PC., Xu RM., Lin PC., Xu RM. rmxu@ibp.ac.cn Accepted 2016-MAR-07 AT 11:53 GMT AT 11:53 GMT by ORCHARD The EMBO journal 2012 imex curation Structure and assembly of the SF3a splicing factor complex of U2 snRNP. Structure and assembly of the SF3a splicing factor complex of U2 snRNP. The EMBO journal 2012 imex curation Lin PC., Xu RM., Lin PC., Xu RM. rmxu@ibp.ac.cn 11-Apr-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight by staining molecular weight estimation by staining weight by staining Lin PC., Xu RM., Lin PC., Xu RM. rmxu@ibp.ac.cn Accepted 2016-MAR-07 AT 11:53 GMT AT 11:53 GMT by ORCHARD The EMBO journal 2012 imex curation prp21_yeast Pre-mRNA-splicing factor PRP21 PRP21 SPP91 YJL203W J0322 protein protein yeast Saccharomyces cerevisiae Baker's yeast MEPEDTQLKEDIKTTVNYIKQHGVEFENKLLEDERFSFIKKDDPLHEYYTKLMNEPTDTVSGEDNDRKSEREIARPPDFLFSQYDTGISRRDMEVIKLTARYYAKDKSIVEQMISKDGEARLNFMNSSHPLHKTFTDFVAQYKRVYSFTGQEIKKSKRTILDNCFERTQYWEFEKDKDREHDKLVELCKIQFAAIPWDKFTQVAKFSIPEDTEIFEGSLDLEQMRLRRVQTGIKLFDSIKPTNEEEKIVSDQGKQKGGDSKGKKRKIRAVGETRLKKSKK 2E9DBA6F06759B3F 2E9DBA6F06759B3F prp11_yeast Pre-mRNA-splicing factor PRP11 PRP11 PRP10 RNA11 YDL043C D2711 protein protein yeast Saccharomyces cerevisiae Baker's yeast MNYLEGVGSKKGGGGIASESQFNLQRRKEVESLLSKGENVPYTFQDEKDDQVRSNPYIYKNHSGKLVCKLCNTMHMSWSSVERHLGGKKHGLNVLRRGISIEKSSLGREGQTTHDFRQQQKIIEAKQSLKNNGTIPVCKIATVKNPKNGSVGLAIQVNYSSEVKENSVDSDDKAKVPPLIRIVSGLELSDTKQKGKKFLVIAYEPFENIAIELPPNEILFSENNDMDNNNDGVDELNKKCTFWDAISKLYYVQFFFKQAEQEQADV D8BA3BB27F36F06F D8BA3BB27F36F06F prp9_yeast Pre-mRNA-splicing factor PRP9 PRP9 D2773 YDL030W protein protein yeast Saccharomyces cerevisiae Baker's yeast MNLLETRRSLLEEMEIIENAIAERIQRNPELYYHYIQESSKVFPDTKLPRSSLIAENKIYKFKKVKRKRKQIILQQHEINIFLRDYQEKQQTFNKINRPEETQEDDKDLPNFERKLQQLEKELKNEDENFELDINSKKDKYALFSSSSDPSRRTNILSDRARDLDLNEIFTRDEQYGEYMELEQFHSLWLNVIKRGDCSLLQFLDILELFLDDEKYLLTPPMDRKNDRYMAFLLKLSKYVETFFFKSYALLDAAAVENLIKSDFEHSYCRGSLRSEAKGIYCPFCSRWFKTSSVFESHLVGKIHKKNESKRRNFVYSEYKLHRYLKYLNDEFSRTRSFVERKLAFTANERMAEMDILTQKYEAPAYDSTEKEGAEQVDGEQRDGQLQEEHLSGKSFDMPLGPDGLPMPYWLYKLHGLDREYRCEICSNKVYNGRRTFERHFNEERHIYHLRCLGIEPSSVFKGITKIKEAQELWKNMQGQSQLTSIAAVPPKPNPSQLKVPTELELEEEDEEGNVMSKKVYDELKKQGLV 9020885E620488F3 9020885E620488F3 lsr1_snr20_u2 yeast small nuclear RNA U2 yeast snrna small nuclear rna snRNA snrna yeast Saccharomyces cerevisiae Baker's yeast ACGAAUCUCUUUGCCUUUUGGCUUAGAUCAAGUGUAGUAUCUGUUCUUUUCAGUGUAACAACUGAAAUGACCUCAAUGAGGCUCAUUACCUUUUAAUUUGUUACAAUACACAUUUUUUGGCACCCAAAAUAAUAAAAUGGACGGGAAGAGACUUUUUAAGCAAGUUGUUUUCCGCUAAUGUCAGGUCUCACUACUUUUUGCUGCUAUUUUUCUUCGCUCAUGGUUUCUUCAUAAGGCGUUUUUAUGAUGGUUUUUCGAAAUUGGUUUUUGAGACGACGGUUGCUCAAGGUUAUUGUUUUUGUUUUCUUCUGGUUGUUUUCUAUUUUCUUUUUUUUAGCUUUCUGUUUCUCCCUUAGUUUGGCUUUUUGCUUCAUACUCUUCCCUGUCUUUCCGAGCCGUUUAUGUCCAACGCGGGAUUUGGUUUUUCUUUAUCGAUGGGAAGAAAUGGUGCUAUAGUAGGUUGGGAGAUAAUAUUUAUGGUAUGGGGUGCUAGUGCGGAUGGGGCGCUCUUAUUGUUGAUUUCUUCGCUCGUCUUCUUUUUCUGGUGGCGCUGCAAGAGGAAGUUUUUCGACUUUGUUAUGAUUUUUGGUUUGCAAGGAAAGGUGUCUUACGAUUCUUUUUUUGAUGUAAUAGGAUAAGCUUGCUUAUCCCCCAAGUAUCGGCCAAAGUUGUUGAUUUUCCUUUUGAAGUGUCCUCGGUUUGAGGGGGUGUAGGGUGGGGUUGGUCUACAAUAAGAGUGUUCCAUUGUUAACGUGCUGGCGUCUUUUACUAUAUUUUUUUUCCCAGUUUAUUUUGUGCUUAUUUUCUCAUUGAGGAGAAGGAGCUCUUCUCGCAGGAUAUAAAUGGAGGUUUGCUAAAGGGGAGGAGAUGUGUUUGUGAGAAUACUGCUGAGAGAGUUCUGGAAGAGAAAAAAAGGAGGCAAUGGAAGGCGUUUGCUGGGAAAAGAGAAGAGCCAUGACUGCAUCUGUUGUUUCAAGGCCAGUUUUAUUAACCGCCUAUGUCAUAGAGGCGUUUUUUUUGGAGGGAUUUGAAGAAUGCCGGCGGCAUCAAGAAACGGACUUGAUGGUUGACGCCUGUUUUUAAAGUUAGAGACGUCGCGACCCUCGCACUUGUGGAGUCGUUCUUGACUUUUACUUUGGUCGCUUGAUGUUUCUCUCGUCUUCCCGUUCGCUCUU prp11-prp21-5 1 5 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) physical association physical association Fig2 R working 22.8%, R free 27.8% snru2 yeast-prp21-1 2 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) association association Fig7B snru2 yeast-prp11-1 2 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) association association Fig7A, D snru2 yeast-prp11-3 2 5 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain P19736:p.[Lys302Glu;Lys305Glu;Lys306Glu] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain K E certain certain sequence position certain certain certain sequence position certain K E certain certain sequence position certain certain certain sequence position certain K E Wed May 02 16:30:38 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys302glu,lys305glu,lys306glu' Tue Jun 30 16:54:35 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys302Glu;Lys305Glu;Lys306Glu]' ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 3 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) association association Fig7A, D