IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Screen performed in the presence of Estradiol CHEBI:23965. shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Human testis cDNA Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Source of NCOA1/SRC-1 traced back to PMID:7481822 shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro anti tag coip anti tag coimmunoprecipitation anti tag coip weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer Assay performed in the presence of Estradiol CHEBI:23965. shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-lncap Human caucasian prostate carcinoma lncap Human caucasian prostate adenocarcinoma fluorescence imaging fluorescence microscopy fluorescence imaging immunostaining immunostaining Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. CCDC62/ERAP75 functions as a coactivator to enhance estrogen receptor beta-mediated transactivation and target gene expression in prostate cancer cells. Carcinogenesis 2009 imex curation Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu 09-May-2019: Contacted by IntAct-Help. Only protein-protein interactions imex curation chlae-cos_1 Chlorocebus aethiops COS-1 cells Grivet cos_1 CV-1 Simian cells (cercopithecus aethiops) transformed by SV40 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S., Chen M., Ni J., Chang HC., Lin CY., Muyan M., Yeh S. Cancer - Interactions investigated in the context of cancer shuyuan_yeh@urmc.rochester.edu Accepted 2018-JUL-15 AT 20:14 BST AT 20:14 BST by ORCHARD Carcinogenesis 2009 Only protein-protein interactions imex curation imex curation q92731-1 Estrogen receptor beta Nuclear receptor subfamily 3 group A member 2 Beta-1 ESR2 ESTRB NR3A2 protein protein human Homo sapiens Human MDIKNSPSSLNSPSSYNCSQSILPLEHGSIYIPSSYVDSHHEYPAMTFYSPAVMNYSIPSNVTNLEGGPGRQTTSPNVLWPTPGHLSPLVVHRQLSHLYAEPQKSPWCEARSLEHTLPVNRETLKRKVSGNRCASPVTGPGSKRDAHFCAVCSDYASGYHYGVWSCEGCKAFFKRSIQGHNDYICPATNQCTIDKNRRKSCQACRLRKCYEVGMVKCGSRRERCGYRLVRRQRSADEQLHCAGKAKRSGGHAPRVRELLLDALSPEQLVLTLLEAEPPHVLISRPSAPFTEASMMMSLTKLADKELVHMISWAKKIPGFVELSLFDQVRLLESCWMEVLMMGLMWRSIDHPGKLIFAPDLVLDRDEGKCVEGILEIFDMLLATTSRFRELKLQHKEYLCVKAMILLNSSMYPLVTATQDADSSRKLAHLLNAVTDALVWVIAKSGISSQQQSMRLANLLMLLSHVRHASNKGMEHLLNMKCKNVVPVYDLLLEMLNAHVLRGCKSSITGSECSPAEDSKSKEGSQNPQSQ 8CAE34215992418A esr2_human Estrogen receptor beta ESR2 ESTRB NR3A2 Nuclear receptor subfamily 3 group A member 2 protein protein human Homo sapiens Human MDIKNSPSSLNSPSSYNCSQSILPLEHGSIYIPSSYVDSHHEYPAMTFYSPAVMNYSIPSNVTNLEGGPGRQTTSPNVLWPTPGHLSPLVVHRQLSHLYAEPQKSPWCEARSLEHTLPVNRETLKRKVSGNRCASPVTGPGSKRDAHFCAVCSDYASGYHYGVWSCEGCKAFFKRSIQGHNDYICPATNQCTIDKNRRKSCQACRLRKCYEVGMVKCGSRRERCGYRLVRRQRSADEQLHCAGKAKRSGGHAPRVRELLLDALSPEQLVLTLLEAEPPHVLISRPSAPFTEASMMMSLTKLADKELVHMISWAKKIPGFVELSLFDQVRLLESCWMEVLMMGLMWRSIDHPGKLIFAPDLVLDRDEGKCVEGILEIFDMLLATTSRFRELKLQHKEYLCVKAMILLNSSMYPLVTATQDADSSRKLAHLLNAVTDALVWVIAKSGISSQQQSMRLANLLMLLSHVRHASNKGMEHLLNMKCKNVVPVYDLLLEMLNAHVLRGCKSSITGSECSPAEDSKSKEGSQNPQSQ DIP protein Q92731 original sequence version: 171 8CAE34215992418A estrogen response element Estrogen response element ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GATCTCTTTGATCAGGTCACTGTGACCTGACTTTG ccnd1_human_gene Human Cyclin D1 gene gene gene human Homo sapiens Human ccd62_human Coiled-coil domain-containing protein 62 Protein TSP-NY Protein aaa CCDC62 protein protein human Homo sapiens Human MNPPAAFLAGRQNIGSEVEISTIEKQRKELQLLIGELKDRDKELNDMVAVHQQQLLSWEEDRQKVLTLEERCSKLEGELHKRTEIIRSLTKKVKALESNQMECQTALQKTQLQLQEMAQKATHSSLLSEDLEARNETLSNTLVELSAQVGQLQAREQALTTMIKLKDKDIIEAVNHIADCSGKFKMLEHALRDAKMAETCIVKEKQDYKQKLKALKIEVNKLKEDLNEKTTENNEQREEIIRLKQEKSCLHDELLFTVEREKRKDELLNIAKSKQERTNSELHNLRQIYVKQQSDLQFLNFNVENSQELIQMYDSKMEESKALDSSRDMCLSDLENNHPKVDIKREKNQKSLFKDQKFEAMLVQQNRSDKSSCDECKEKKQQIDTVFGEKSVITLSSIFTKDLVEKHNLPWSLGGKTQIEPENKITLCKIHTKSPKCHGTGVQNEGKQPSETPTLSDEKQWHDVSVYLGLTNCPSSKHPEKLDVECQDQMERSEISCCQKNEACLGESGMCDSKCCHPSNFIIEAPGHMSDVEWMSIFKPSKMQRIVRLKSGCTCSESICGTQHDSPASELIAIQDSHSLGSSKSALREDETESSSNKKNSPTSLLIYKDAPAFNEKASIVLPSQDDFSPTSKLQRLLAESRQMVTDLELSTLLPISHENLTGSATNKSEVPEESAQKNTFVSY 071DCEC789E4DF60 ncoa1_human Nuclear receptor coactivator 1 Steroid receptor coactivator 1 RIP160 Protein Hin-2 Renal carcinoma antigen NY-REN-52 NCOA1 SRC1 BHLHE74 Class E basic helix-loop-helix protein 74 protein protein human Homo sapiens Human MSGLGDSSSDPANPDSHKRKGSPCDTLASSTEKRRREQENKYLEELAELLSANISDIDSLSVKPDKCKILKKTVDQIQLMKRMEQEKSTTDDDVQKSDISSSSQGVIEKESLGPLLLEALDGFFFVVNCEGRIVFVSENVTSYLGYNQEELMNTSVYSILHVGDHAEFVKNLLPKSLVNGVPWPQEATRRNSHTFNCRMLIHPPDEPGTENQEACQRYEVMQCFTVSQPKSIQEDGEDFQSCLICIARRLPRPPAITGVESFMTKQDTTGKIISIDTSSLRAAGRTGWEDLVRKCIYAFFQPQGREPSYARQLFQEVMTRGTASSPSYRFILNDGTMLSAHTKCKLCYPQSPDMQPFIMGIHIIDREHSGLSPQDDTNSGMSIPRVNPSVNPSISPAHGVARSSTLPPSNSNMVSTRINRQQSSDLHSSSHSNSSNSQGSFGCSPGSQIVANVALNQGQASSQSSNPSLNLNNSPMEGTGISLAQFMSPRRQVTSGLATRPRMPNNSFPPNISTLSSPVGMTSSACNNNNRSYSNIPVTSLQGMNEGPNNSVGFSASSPVLRQMSSQNSPSRLNIQPAKAESKDNKEIASILNEMIQSDNSSSDGKPLDSGLLHNNDRLSDGDSKYSQTSHKLVQLLTTTAEQQLRHADIDTSCKDVLSCTGTSNSASANSSGGSCPSSHSSLTERHKILHRLLQEGSPSDITTLSVEPDKKDSASTSVSVTGQVQGNSSIKLELDASKKKESKDHQLLRYLLDKDEKDLRSTPNLSLDDVKVKVEKKEQMDPCNTNPTPMTKPTPEEIKLEAQSQFTADLDQFDQLLPTLEKAAQLPGLCETDRMDGAVTSVTIKSEILPASLQSATARPTSRLNRLPELELEAIDNQFGQPGTGDQIPWTNNTVTAINQSKSEDQCISSQLDELLCPPTTVEGRNDEKALLEQLVSFLSGKDETELAELDRALGIDKLVQGGGLDVLSERFPPQQATPPLIMEERPNLYSQPYSSPSPTANLPSPFQGMVRQKPSLGTMPVQVTPPRGAFSPGMGMQPRQTLNRPPAAPNQLRLQLQQRLQGQQQLIHQNRQAILNQFAATAPVGINMRSGMQQQITPQPPLNAQMLAQRQRELYSQQHRQRQLIQQQRAMLMRQQSFGNNLPPSSGLPVQMGNPRLPQGAPQQFPYPPNYGTNPGTPPASTSPFSQLAANPEASLANRNSMVSRGMTGNIGGQFGTGINPQMQQNVFQYPGAGMVPQGEANFAPSLSPGSSMVPMPIPPPQSSLLQQTPPASGYQSPDMKAWQQGAIGNNNVFSQAVQNQPTPAQPGVYNNMSITVSMAGGNTNVQNMNPMMAQMQMSSLQMPGMNTVCPEQINDPALRHTGLYCNQLSSTDLLKTEADGTQQVQQVQVFADVQCTVNLVGGDPYLNQPGPLGTQKPTSGPQTPQAQQKSLLQQLLTE DIP protein Q15788-1 original sequence version: 60 DIP protein Q15788-1 original sequence version: 62 DIP protein Q15788 original sequence version: 88 DIP protein Q15788 original sequence version: 107 DIP protein Q15788 original sequence version: 96 25EF6F389489121E esr2-ccdc62-1 3 11 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 15 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 21 19 physical association physical association esr2-ncoa1-1 3 16 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association esr2-ccdc62-2 4 11 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 15 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 28 30 physical association physical association Fig. 1A, 1B Estradiol CHEBI:23965 esr2-ncoa1-2 4 16 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association Fig. 1A., 1B Estradiol CHEBI:23965 esr2-ccdc62-3 9 12 unspecified role unspecified role neutral component neutral component 15 unspecified role unspecified role neutral component neutral component colocalization colocalization Estradiol CHEBI:23965 Fig. 2D ccdc62-esr2-1 5 12 unspecified role unspecified role bait bait 15 unspecified role unspecified role prey prey physical association physical association Estradiol CHEBI:23965 Fig. 3C esr2-ccdc62-4 6 11 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 15 unspecified role unspecified role bait bait region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction Fig. 3B CHEBI:16469 CHEBI:16469 activates q92731-1 (GO:0005515) esr2-ccdc62-5 10 11 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region gal4 dna bd gal4 dna binding domain gal4 dna bd undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 15 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region vp16 ad vp16 activation domain vp16 ad undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain 53 50 physical association physical association Fig. 3A, 4D Estradiol CHEBI:23965 Fulvestrant (ICI-182780 CHEBI:31638) estrogen response element-esr2-1 1 12 unspecified role unspecified role prey prey purified purified in vitro In vitro 13 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Fig. 3D esr2-estrogen response element-1 2 12 unspecified role unspecified role prey prey purified purified in vitro In vitro 13 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Fig. 3D CHEBI:16469 esr2-estrogen response element-2 2 13 competitor competitor competitor prey prey region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined G_T16-17T_A mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain GT TA 12 unspecified role unspecified role prey prey purified purified chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro physical association physical association Fig. 3D CHEBI:16469 esr2-ccdc62-6 2 15 unspecified role unspecified role prey prey in vitro In vitro 12 unspecified role unspecified role prey prey purified purified in vitro In vitro 13 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3D CHEBI:16469 ccdc62-ccnd1_human_gene-1 8 15 unspecified role unspecified role bait bait 14 unspecified role unspecified role prey prey AP-1 site_promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3E Estradiol CHEBI:23965 CHEBI:23965 increases expression at RNA level of ENSG00000110092 Q6P9F0 increases expression at RNA level of ENSG00000110092 P10275 causes no change at RNA level to ENSG00000110092 esr2-ccdc62-7 7 11 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 15 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro direct interaction direct interaction Fig. 4A CHEBI:16469 ccdc62-esr2-2 7 11 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 15 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain LXXLL motif required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 4B, 4C CHEBI:16469