IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Cell (0092-8674) 2014 imex curation Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. Chitin binding tags added with an Intein sequence so may not be present on the final molecule. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org Accepted 2015-JAN-20 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Cell (0092-8674) 2014 imex curation Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions arath-protoplast Arabidopsis thaliana protoplast Protoplast defined as a membrane-bound cell from which the outer wall has been partially or completely removed. fret fluorescent resonance energy transfer FRET RET FRET analysis FRET RET FRET analysis fret tag fluorescence tag visualisation by fluorescence tag fluorescence Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. Chitin binding tags added with an Intein sequence so may not be present on the final molecule. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org Accepted 2015-JAN-20 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Cell (0092-8674) 2014 imex curation Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro saxs x ray scattering saxs predetermined predetermined participant predetermined Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. Chitin binding tags added with an Intein sequence so may not be present on the final molecule. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org Accepted 2015-JAN-20 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Structural Basis for DNA Binding Specificity by the Auxin-Dependent ARF Transcription Factors. Cell (0092-8674) 2014 imex curation Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro spr surface plasmon resonance Optical biosensor BIAcore(r) BIAcore(r) Optical biosensor spr predetermined predetermined participant predetermined Boer D.R., Freire-Rios A., van den Berg W.A., Saaki T., Manfield I.W., Kepinski S., López-Vidrieo I., Franco-Zorrilla J.M., de Vries S.C., Solano R., Weijers D., Coll M. Chitin binding tags added with an Intein sequence so may not be present on the final molecule. Interactions with other oligonucleotides was not captured as sequences not available. dolf.weijers@wur.nl, miquel.coll@irbbarcelona.org Accepted 2015-JAN-20 by PPORRAS Cell (0092-8674) 2014 Only protein-protein interactions imex curation er7_arath_dna canonical auxin-response element ER7 ds dna double stranded deoxyribonucleic acid ds DNA ds dna arath Arabidopsis thaliana (Mouse-ear cress) Mouse-ear cress TTGTCTCCCTTTGGGAGACAA arfa_arath Auxin response factor 1 ARF1 F23H11.7 At1g59750 protein protein arath Arabidopsis thaliana (Mouse-ear cress) Mouse-ear cress MAASNHSSGKPGGVLSDALCRELWHACAGPLVTLPREGERVYYFPEGHMEQLEASMHQGLEQQMPSFNLPSKILCKVINIQRRAEPETDEVYAQITLLPELDQSEPTSPDAPVQEPEKCTVHSFCKTLTASDTSTHGGFSVLRRHADDCLPPLDMSQQPPWQELVATDLHNSEWHFRHIFRGQPRRHLLTTGWSVFVSSKKLVAGDAFIFLRGENEELRVGVRRHMRQQTNIPSSVISSHSMHIGVLATAAHAITTGTIFSVFYKPRTSRSEFIVSVNRYLEAKTQKLSVGMRFKMRFEGEEAPEKRFSGTIVGVQENKSSVWHDSEWRSLKVQWDEPSSVFRPERVSPWELEPLVANSTPSSQPQPPQRNKRPRPPGLPSPATGPSGPVTPDGVWKSPADTPSSVPLFSPPAKAATFGHGGNKSFGVSIGSAFWPTNADSAAESFASAFNNESTEKKQTNGNVCRLFGFELVENVNVDECFSAASVSGAVAVDQPVPSNEFDSGQQSEPLNINQSDIPSGSGDPEKSSLRSPQESQSRQIRSCTKVHMQGSAVGRAIDLTRSECYEDLFKKLEEMFDIKGELLESTKKWQVVYTDDEDDMMMVGDDPWNEFCGMVRKIFIYTPEEVKKLSPKNKLAVNARMQLKADAEENGNTEGRSSSMAGSR 79DD3180C2091401 arfe_arath Auxin response factor 5 Transcription factor MONOPTEROS Auxin-responsive protein IAA24 ARF5 IAA24 MP At1g19850 F6F9.10 protein protein arath Arabidopsis thaliana (Mouse-ear cress) Mouse-ear cress MMASLSCVEDKMKTSCLVNGGGTITTTTSQSTLLEEMKLLKDQSGTRKPVINSELWHACAGPLVCLPQVGSLVYYFSQGHSEQVAVSTRRSATTQVPNYPNLPSQLMCQVHNVTLHADKDSDEIYAQMSLQPVHSERDVFPVPDFGMLRGSKHPTEFFCKTLTASDTSTHGGFSVPRRAAEKLFPPLDYSAQPPTQELVVRDLHENTWTFRHIYRGQPKRHLLTTGWSLFVGSKRLRAGDSVLFIRDEKSQLMVGVRRANRQQTALPSSVLSADSMHIGVLAAAAHATANRTPFLIFYNPRACPAEFVIPLAKYRKAICGSQLSVGMRFGMMFETEDSGKRRYMGTIVGISDLDPLRWPGSKWRNLQVEWDEPGCNDKPTRVSPWDIETPESLFIFPSLTSGLKRQLHPSYFAGETEWGSLIKRPLIRVPDSANGIMPYASFPSMASEQLMKMMMRPHNNQNVPSFMSEMQQNIVMGNGGLLGDMKMQQPLMMNQKSEMVQPQNKLTVNPSASNTSGQEQNLSQSMSAPAKPENSTLSGCSSGRVQHGLEQSMEQASQVTTSTVCNEEKVNQLLQKPGASSPVQADQCLDITHQIYQPQSDPINGFSFLETDELTSQVSSFQSLAGSYKQPFILSSQDSSAVVLPDSTNSPLFHDVWDTQLNGLKFDQFSPLMQQDLYASQNICMSNSTTSNILDPPLSNTVLDDFCAIKDTDFQNHPSGCLVGNNNTSFAQDVQSQITSASFADSQAFSRQDFPDNSGGTGTSSSNVDFDDCSLRQNSKGSSWQKIATPRVRTYTKVQKTGSVGRSIDVTSFKDYEELKSAIECMFGLEGLLTHPQSSGWKLVYVDYESDVLLVGDDPWEEFVGCVRCIRILSPTEVQQMSEEGMKLLNSAGINDLKTSVS D20D348369757F09 arfc_arath Auxin response factor 3 ARF3 ETT Protein ETTIN T1B8.30 At2g33860 protein protein arath Arabidopsis thaliana (Mouse-ear cress) Mouse-ear cress MGGLIDLNVMETEEDETQTQTPSSASGSVSPTSSSSASVSVVSSNSAGGGVCLELWHACAGPLISLPKRGSLVLYFPQGHLEQAPDFSAAIYGLPPHVFCRILDVKLHAETTTDEVYAQVSLLPESEDIERKVREGIIDVDGGEEDYEVLKRSNTPHMFCKTLTASDTSTHGGFSVPRRAAEDCFPPLDYSQPRPSQELLARDLHGLEWRFRHIYRGQPRRHLLTTGWSAFVNKKKLVSGDAVLFLRGDDGKLRLGVRRASQIEGTAALSAQYNQNMNHNNFSEVAHAISTHSVFSISYNPKASWSNFIIPAPKFLKVVDYPFCIGMRFKARVESEDASERRSPGIISGISDLDPIRWPGSKWRCLLVRWDDIVANGHQQRVSPWEIEPSGSISNSGSFVTTGPKRSRIGFSSGKPDIPVSEGIRATDFEESLRFQRVLQGQEIFPGFINTCSDGGAGARRGRFKGTEFGDSYGFHKVLQGQETVPAYSITDHRQQHGLSQRNIWCGPFQNFSTRILPPSVSSSPSSVLLTNSNSPNGRLEDHHGGSGRCRLFGFPLTDETTAVASATAVPCVEGNSMKGASAVQSNHHHSQGRDIYAMRDMLLDIAL 4BE93292324D354B arf1-1 1 6 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4LDV 1.45A 4LDW 2.67A 4LDV Rworking = 21% Rfree = 24% 4LDV Rworking = 22% Rfree = 28% Supp. Table 1 arf1-er7 1 6 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role neutral component neutral component direct interaction direct interaction 4LDX 2.9A 4LDX Rworking = 21% Rfree = 26% Supp. Table 1 arf1-1 1 6 unspecified role unspecified role neutral component neutral component chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Q8L7G0:p.Gly245Ala mutation mutation certain certain sequence position certain certain certain sequence position certain G A Wed May 02 16:51:01 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly245ala' Tue Jun 30 19:31:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly245Ala' region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain direct interaction direct interaction 4LDY 2.3A 4LDV Rworking = 21% Rfree = 26% Supp. Table 1 arf5-1 1 7 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Suppl. Table 1 Rworking 19.5% Rfree 25.2% 2.15A er7-arf1 4 6 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role bait bait g3x mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain direct interaction direct interaction Mutating both AuxRE sites completely abrogated binding . Consistent with cooperative binding, mutating only one of the two AuxRE sites reduced the affinity more than 2-fold Figures 3E, 6B Supp Figs. 3F Supp Table 2 er7-arf5 4 5 unspecified role unspecified role bait bait g3x mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain 7 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P93024:p.Ala282Asn mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A N Wed May 02 14:47:44 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ala282asn' Tue Jun 30 18:19:04 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ala282Asn' P93024:p.Ser269Asn mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S N Wed May 02 15:17:43 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser269asn' Tue Jun 30 18:07:52 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser269Asn' P93024:p.Gly279Glu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G E Wed May 02 15:13:41 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279glu' Tue Jun 30 18:21:09 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Glu' P93024:p.His170Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain H A Wed May 02 15:40:45 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'his170ala' Tue Jun 30 19:13:36 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.His170Ala' P93024:p.Arg215Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain R A Wed May 02 14:41:34 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg215ala' Tue Jun 30 16:44:06 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg215Ala' direct interaction direct interaction Mutating both AuxRE sites completely abrogated binding . Consistent with cooperative binding, mutating only one of the two AuxRE sites reduced the affinity more than 2-fold Figures 3F, 3G, 4C, 6C Supp Figs. 3G Supp Table 2 arf1-1 3 6 unspecified role unspecified role neutral component neutral component chitin binding tag fusion protein fusion protein undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain direct interaction direct interaction Fig. 2A arf5-arf5-4 2 7 unspecified role unspecified role fluorescence donor fluorescence donor region cfp tag cyan fluorescent protein tag CFP cyan fluorescent protein cyan fluorescent protein CFP cfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P93024:p.Gly279Glu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G E Wed May 02 19:41:32 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279glu' Tue Jun 30 15:39:52 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Glu' c-terminal region sufficient to bind sufficient binding region sufficient to bind range range range range P93024:p.Gly279Ile mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G I Wed May 02 17:52:10 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279ile' Tue Jun 30 17:45:51 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Ile' 7 unspecified role unspecified role fluorescence accept fluorescence acceptor fluorescence accept P93024:p.Gly279Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G A Wed May 02 17:52:18 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279ala' Tue Jun 30 18:30:40 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Ala' c-terminal region sufficient to bind sufficient binding region sufficient to bind range range range range P93024:p.Gly279Ile mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G I Wed May 02 16:15:16 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279ile' Tue Jun 30 19:08:50 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Ile' region yfp tag yellow fluorescent protein tag YFP yellow fluorescent protein yellow fluorescent protein YFP yfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P93024:p.Gly279Glu mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain G E Wed May 02 16:58:33 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly279glu' Tue Jun 30 19:11:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly279Glu' 52 56 proximity proximity close-contact colocalization neighbourhood interaction Fig. 2E arf3-arf3 2 8 unspecified role unspecified role fluorescence donor fluorescence donor region cfp tag cyan fluorescent protein tag CFP cyan fluorescent protein cyan fluorescent protein CFP cfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role fluorescence accept fluorescence acceptor fluorescence accept region yfp tag yellow fluorescent protein tag YFP yellow fluorescent protein yellow fluorescent protein YFP yfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined proximity proximity close-contact colocalization neighbourhood interaction Fig. 2E