IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. Complex first purified on a talon column and then by anti-Flag column chromatography. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection pull down pull down western blot western blot Immuno blot Immuno blot Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro cleavage cleavage assay cleavage weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. Nucleotide sequence at the 3-prime end of the pre-let-7a sequence may vary in the last 6 residues. Captured the simple cleavage but decided the additional complication of guide/target RNAs and RISC loading was beyond our current capabilities. siRNA data not added as species not given. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. ADAR1 forms a complex with Dicer to promote microRNA processing and RNA-induced gene silencing. Cell (0092-8674) 2013 imex curation Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org 30-Sept-2013: Contacted by IntAct-Help. Only protein-protein interactions spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Ota H., Sakurai M., Gupta R., Valente L., Wulff B.E., Ariyoshi K., Iizasa H., Davuluri R.V., Nishikura K. kazuko@wistar.org Accepted 2013-SEP-19 by MGT 30-Sept-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation trbp2_human RISC-loading complex subunit TARBP2 Trans-activation-responsive RNA-binding protein TARBP2 TRBP TAR RNA-binding protein 2 protein protein human Homo sapiens Human MSEEEQGSGTTTGCGLPSIEQMLAANPGKTPISLLQEYGTRIGKTPVYDLLKAEGQAHQPNFTFRVTVGDTSCTGQGPSKKAAKHKAAEVALKHLKGGSMLEPALEDSSSFSPLDSSLPEDIPVFTAAAAATPVPSVVLTRSPPMELQPPVSPQQSECNPVGALQELVVQKGWRLPEYTVTQESGPAHRKEFTMTCRVERFIEIGSGTSKKLAKRNAAAKMLLRVHTVPLDARDGNEVEPDDDHFSIGVGSRLDGLRNRGPGCTWDSLRNSVGEKILSLRSCSLGSLGALGPACCRVLSELSEEQAFHVSYLDIEELSLSGLCQCLVELSTQPATVCHGSATTREAARGEAARRALQYLKIMAGSK DIP protein Q15633 original sequence version: 71 DIP protein Q15633 original sequence version: 117 DIP protein Q15633 original sequence version: 99 DIP protein Q15633-1 original sequence version: 94 DIP protein Q15633 original sequence version: 122 768BA11751DA4912 p55265-5 Double-stranded RNA-specific adenosine deaminase ADAR1S p110 ADAR ADAR1 DSRAD G1P1 IFI4 136 kDa double-stranded RNA-binding protein K88DSRBP Interferon-inducible protein 4 protein protein human Homo sapiens Human MAEIKEKICDYLFNVSDSSALNLAKNIGLTKARDINAVLIDMERQGDVYRQGTTPPIWHLTDKKRERMQIKRNTNSVPETAPAAIPETKRNAEFLTCNIPTSNASNNMVTTEKVENGQEPVIKLENRQEARPEPARLKPPVHYNGPSKAGYVDFENGQWATDDIPDDLNSIRAAPGEFRAIMEMPSFYSHGLPRCSPYKKLTECQLKNPISGLLEYAQFASQTCEFNMIEQSGPPHEPRFKFQVVINGREFPPAEAGSKKVAKQDAAMKAMTILLEEAKAKDSGKSEESSHYSTEKESEKTAESQTPTPSATSFFSGKSPVTTLLECMHKLGNSCEFRLLSKEGPAHEPKFQYCVAVGAQTFPSVSAPSKKVAKQMAAEEAMKALHGEATNSMASDNQPEGMISESLDNLESMMPNKVRKIGELVRYLNTNPVGGLLEYARSHGFAAEFKLVDQSGPPHEPKFVYQAKVGGRWFPAVCAHSKKQGKQEAADAALRVLIGENEKAERMGFTEVTPVTGASLRRTMLLLSRSPEAQPKTLPLTGSTFHDQIAMLSHRCFNTLTNSFQPSLLGRKILAAIIMKKDSEDMGVVVSLGTGNRCVKGDSLSLKGETVNDCHAEIISRRGFIRFLYSELMKYNSQTAKDSIFEPAKGGEKLQIKKTVSFHLYISTAPCGDGALFDKSCSDRAMESTESRHYPVFENPKQGKLRTKVENGEGTIPVESSDIVPTWDGIRLGERLRTMSCSDKILRWNVLGLQGALLTHFLQPIYLKSVTLGYLFSQGHLTRAICCRVTRDGSAFEDGLRHPFIVNHPKVGRVSIYDSKRQSGKTKETSVNWCLADGYDLEILDGTRGTVDGPRNELSRVSKKNIFLLFKKLCSFRYRRDLLRLSYGEAKKAARDYETAKNYFKKGLKDMGYGNWISKPQEEKNFYLCPV Produced by alternative promoter usage. 9CE095D6F9C1BC79 ago2_human Protein argonaute-2 AGO2 Argonaute RISC catalytic component 2 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer protein protein human Homo sapiens Human MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA DIP protein Q9UKV8 original sequence version: 1(def) DIP protein Q9UKV8 original sequence version: 44 DIP protein Q9UKV8 original sequence version: 60 DIP protein Q9UKV8 original sequence version: 62 DIP protein Q9UKV8 original sequence version: 89 DIP protein Q9UKV8 original sequence version: 85 DIP protein Q9UKV8 original sequence version: 87 DIP protein Q9UKV8 original sequence version: 99 DIP protein Q9UKV8 original sequence version: 117 DIP protein Q9UKV8-1 original sequence version: 117 DIP protein Q9UKV8 original sequence version: 145 DIP protein Q9UKV8 original sequence version: 108 5C8552C43FC81345 p55265-1 Double-stranded RNA-specific adenosine deaminase ADAR ADAR1 DSRAD G1P1 IFI4 136 kDa double-stranded RNA-binding protein K88DSRBP Interferon-inducible protein 4 ADAR-a ADAR1L p150 protein protein human Homo sapiens Human MNPRQGYSLSGYYTHPFQGYEHRQLRYQQPGPGSSPSSFLLKQIEFLKGQLPEAPVIGKQTPSLPPSLPGLRPRFPVLLASSTRGRQVDIRGVPRGVHLRSQGLQRGFQHPSPRGRSLPQRGVDCLSSHFQELSIYQDQEQRILKFLEELGEGKATTAHDLSGKLGTPKKEINRVLYSLAKKGKLQKEAGTPPLWKIAVSTQAWNQHSGVVRPDGHSQGAPNSDPSLEPEDRNSTSVSEDLLEPFIAVSAQAWNQHSGVVRPDSHSQGSPNSDPGLEPEDSNSTSALEDPLEFLDMAEIKEKICDYLFNVSDSSALNLAKNIGLTKARDINAVLIDMERQGDVYRQGTTPPIWHLTDKKRERMQIKRNTNSVPETAPAAIPETKRNAEFLTCNIPTSNASNNMVTTEKVENGQEPVIKLENRQEARPEPARLKPPVHYNGPSKAGYVDFENGQWATDDIPDDLNSIRAAPGEFRAIMEMPSFYSHGLPRCSPYKKLTECQLKNPISGLLEYAQFASQTCEFNMIEQSGPPHEPRFKFQVVINGREFPPAEAGSKKVAKQDAAMKAMTILLEEAKAKDSGKSEESSHYSTEKESEKTAESQTPTPSATSFFSGKSPVTTLLECMHKLGNSCEFRLLSKEGPAHEPKFQYCVAVGAQTFPSVSAPSKKVAKQMAAEEAMKALHGEATNSMASDNQPEGMISESLDNLESMMPNKVRKIGELVRYLNTNPVGGLLEYARSHGFAAEFKLVDQSGPPHEPKFVYQAKVGGRWFPAVCAHSKKQGKQEAADAALRVLIGENEKAERMGFTEVTPVTGASLRRTMLLLSRSPEAQPKTLPLTGSTFHDQIAMLSHRCFNTLTNSFQPSLLGRKILAAIIMKKDSEDMGVVVSLGTGNRCVKGDSLSLKGETVNDCHAEIISRRGFIRFLYSELMKYNSQTAKDSIFEPAKGGEKLQIKKTVSFHLYISTAPCGDGALFDKSCSDRAMESTESRHYPVFENPKQGKLRTKVENGEGTIPVESSDIVPTWDGIRLGERLRTMSCSDKILRWNVLGLQGALLTHFLQPIYLKSVTLGYLFSQGHLTRAICCRVTRDGSAFEDGLRHPFIVNHPKVGRVSIYDSKRQSGKTKETSVNWCLADGYDLEILDGTRGTVDGPRNELSRVSKKNIFLLFKKLCSFRYRRDLLRLSYGEAKKAARDYETAKNYFKKGLKDMGYGNWISKPQEEKNFYLCPV Produced by alternative promoter usage. 9CE095D6F9C1BC79 dicer_human Endoribonuclease Dicer DICER1 DICER HERNA KIAA0928 Helicase with RNase motif protein protein human Homo sapiens Human MKSPALQPLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLTKELSYQIRGDFSRNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSNLEVNASWTKERWNQEFTKHQVLIMTCYVALNVLKNGYLSLSDINLLVFDECHLAILDHPYREIMKLCENCPSCPRILGLTASILNGKCDPEELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPFTDRSGLYERLLMELEEALNFINDCNISVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEAEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTGETDIDPVMDDDDVFPPYVLRPDDGGPRVTINTAIGHINRYCARLPSDPFTHLAPKCRTRELPDGTFYSTLYLPINSPLRASIVGPPMSCVRLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAIPECLRDSYPRPDQPCYLYVIGMVLTTPLPDELNFRRRKLYPPEDTTRCFGILTAKPIPQIPHFPVYTRSGEVTISIELKKSGFMLSLQMLELITRLHQYIFSHILRLEKPALEFKPTDADSAYCVLPLNVVNDSSTLDIDFKFMEDIEKSEARIGIPSTKYTKETPFVFKLEDYQDAVIIPRYRNFDQPHRFYVADVYTDLTPLSKFPSPEYETFAEYYKTKYNLDLTNLNQPLLDVDHTSSRLNLLTPRHLNQKGKALPLSSAEKRKAKWESLQNKQILVPELCAIHPIPASLWRKAVCLPSILYRLHCLLTAEELRAQTASDAGVGVRSLPADFRYPNLDFGWKKSIDSKSFISISNSSSAENDNYCKHSTIVPENAAHQGANRTSSLENHDQMSVNCRTLLSESPGKLHVEVSADLTAINGLSYNQNLANGSYDLANRDFCQGNQLNYYKQEIPVQPTTSYSIQNLYSYENQPQPSDECTLLSNKYLDGNANKSTSDGSPVMAVMPGTTDTIQVLKGRMDSEQSPSIGYSSRTLGPNPGLILQALTLSNASDGFNLERLEMLGDSFLKHAITTYLFCTYPDAHEGRLSYMRSKKVSNCNLYRLGKKKGLPSRMVVSIFDPPVNWLPPGYVVNQDKSNTDKWEKDEMTKDCMLANGKLDEDYEEEDEEEESLMWRAPKEEADYEDDFLEYDQEHIRFIDNMLMGSGAFVKKISLSPFSTTDSAYEWKMPKKSSLGSMPFSSDFEDFDYSSWDAMCYLDPSKAVEEDDFVVGFWNPSEENCGVDTGKQSISYDLHTEQCIADKSIADCVEALLGCYLTSCGERAAQLFLCSLGLKVLPVIKRTDREKALCPTRENFNSQQKNLSVSCAAASVASSRSSVLKDSEYGCLKIPPRCMFDHPDADKTLNHLISGFENFEKKINYRFKNKAYLLQAFTHASYHYNTITDCYQRLEFLGDAILDYLITKHLYEDPRQHSPGVLTDLRSALVNNTIFASLAVKYDYHKYFKAVSPELFHVIDDFVQFQLEKNEMQGMDSELRRSEEDEEKEEDIEVPKAMGDIFESLAGAIYMDSGMSLETVWQVYYPMMRPLIEKFSANVPRSPVRELLEMEPETAKFSPAERTYDGKVRVTVEVVGKGKFKGVGRSYRIAKSAAARRALRSLKANQPQVPNS 9452B96A601D4551 pre-let-7a pre-let-7a rna ribonucleic acid RNA rna human Homo sapiens Human UGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUC 50335B1DBE2CA90D ncoa6_human Nuclear receptor coactivator 6 NCOA6 KIAA0181 RAP250 Amplified in breast cancer protein 3 Cancer-amplified transcriptional coactivator ASC-2 Activating signal cointegrator 2 Peroxisome proliferator-activated receptor-interacting protein Nuclear receptor-activating protein, 250 kDa Nuclear receptor coactivator RAP250 Thyroid hormone receptor-binding protein AIB3 TRBP protein protein human Homo sapiens Human MVLDDLPNLEDIYTSLCSSTMEDSEMDFDSGLEDDDTKSDSILEDSTIFVAFKGNIDDKDFKWKLDAILKNVPNLLHMESSKLKVQKVEPWNSVRVTFNIPREAAERLRILAQSNNQQLRDLGILSVQIEGEGAINLALAQNRSQDVRMNGPMGAGNSVRMEAGFPMASGPGIIRMNNPATVMIPPGGNVSSSMMAPGPNPELQPRTPRPASQSDAMDPLLSGLHIQQQSHPSGSLAPPHHPMQPVSVNRQMNPANFPQLQQQQQQQQQQQQQQQQQQQQQQQQQLQARPPQQHQQQQPQGIRPQFTAPTQVPVPPGWNQLPSGALQPPPAQGSLGTMTANQGWKKAPLPGPMQQQLQARPSLATVQTPSHPPPPYPFGSQQASQAHTNFPQMSNPGQFTAPQMKSLQGGPSRVPTPLQQPHLTNKSPASSPSSFQQGSPASSPTVNQTQQQMGPRPPQNNPLPQGFQQPVSSPGRNPMVQQGNVPPNFMVMQQQPPNQGPQSLHPGLGGMPKRLPPGFSAGQANPNFMQGQVPSTTATTPGNSGAPQLQANQNVQHAGGQGAGPPQNQMQVSHGPPNMMQPSLMGIHGNMNNQQAGTSGVPQVNLSNMQGQPQQGPPSQLMGMHQQIVPSQGQMVQQQGTLNPQNPMILSRAQLMPQGQMMVNPPSQNLGPSPQRMTPPKQMLSQQGPQMMAPHNQMMGPQGQVLLQQNPMIEQIMTNQMQGNKQQFNTQNQSNVMPGPAQIMRGPTPNMQGNMVQFTGQMSGQMLPQQGPVNNSPSQVMGIQGQVLRPPGPSPHMAQQHGDPATTANNDVSLSQMMPDVSIQQTNMVPPHVQAMQGNSASGNHFSGHGMSFNAPFSGAPNGNQMSCGQNPGFPVNKDVTLTSPLLVNLLQSDISAGHFGVNNKQNNTNANKPKKKKPPRKKKNSQQDLNTPDTRPAGLEEADQPPLPGEQGINLDNSGPKLPEFSNRPPGYPSQPVEQRPLQQMPPQLMQHVAPPPQPPQQQPQPQLPQQQQPPPPSQPQSQQQQQQQQQMMMMLMMQQDPKSVRLPVSQNVHPPRGPLNPDSQRMPMQQSGSVPVMVSLQGPASVPPSPDKQRMPMPVNTPLGSNSRKMVYQESPQNPSSSPLAEMASLPEASGSEAPSVPGGPNNMPSHVVLPQNQLMMTGPKPGPSPLSATQGATPQQPPVNSLPSSHGHHFPNVAAPTQTSRPKTPNRASPRPYYPQTPNNRPPSTEPSEISLSPERLNASIAGLFPPQINIPLPPRPNLNRGFDQQGLNPTTLKAIGQAPSNLTMNPSNFATPQTHKLDSVVVNSGKQSNSGATKRASPSNSRRSSPGSSRKTTPSPGRQNSKAPKLTLASQTNAALLQNVELPRNVLVSPTPLANPPVPGSFPNNSGLNPQNSTVSVAAVGGVVEDNKESLNVPQDSDCQNSQSRKEQVNIELKAVPAQEVKMVVPEDQSKKDGQPSDPNKLPSVEENKNLVSPAMREAPTSLSQLLDNSGAPNVTIKPPGLTDLEVTPPVVSGEDLKKASVIPTLQDLSSSKEPSNSLNLPHSNELCSSLVHPELSEVSSNVAPSIPPVMSRPVSSSSISTPLPPNQITVFVTSNPITTSANTSAALPTHLQSALMSTVVTMPNAGSKVMVSEGQSAAQSNARPQFITPVFINSSSIIQVMKGSQPSTIPAAPLTTNSGLMPPSVAVVGPLHIPQNIKFSSAPVPPNALSSSPAPNIQTGRPLVLSSRATPVQLPSPPCTSSPVVPSHPPVQQVKELNPDEASPQVNTSADQNTLPSSQSTTMVSPLLTNSPGSSGNRRSPVSSSKGKGKVDKIGQILLTKACKKVTGSLEKGEEQYGADGETEGQGLDTTAPGLMGTEQLSTELDSKTPTPPAPTLLKMTSSPVGPGTASAGPSLPGGALPTSVRSIVTTLVPSELISAVPTTKSNHGGIASESLAGGLVEEKVGSHPELLPSIAPSQNLVSKETSTTALQASVARPELEVNAAIVSGQSSEPKEIVEKSKIPGRRNSRTEEPTVASESVENGHRKRSSRPASASSSTKDITSAVQSKRRKSK DIP protein Q14686 original sequence version: 131 DIP protein Q14686 original sequence version: 91 DIP protein Q14686 original sequence version: 92 73219502F5138427 dicer1-adar-8 3 9 unspecified role unspecified role prey prey 10 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey 8 unspecified role unspecified role prey prey association association Fig. 1A ago2-adar-1 3 9 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role prey prey 8 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey 11 unspecified role unspecified role prey prey association association Fig. 1A adar-ago2 3 9 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 11 unspecified role unspecified role prey prey 7 unspecified role unspecified role prey prey association association Fig. 1A adar-ago2-1 5 9 unspecified role unspecified role neutral component neutral component 11 unspecified role unspecified role neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role neutral component neutral component association association Fig. 1B tarbp2-adar 3 9 unspecified role unspecified role prey prey 8 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role prey prey association association Fig. 1A dicer1-adar-1 6 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role prey prey rbd region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Figs. 1C, 2B dicer1-adar-3 6 10 unspecified role unspecified role prey prey region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 1C adar-tarbp2 2 7 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 1C adar-tarbp2-1 2 7 unspecified role unspecified role prey prey 10 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined P55265-1:p.[Lys554_Lys555delinsGluAla;Lys558Ala;Lys665_Lys666delinsGluAla;Lys669Ala;Lys777_Lys778delinsGluAla;Lys781Ala] mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain KK EA certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain KK EA certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain KK EA certain certain sequence position certain certain certain sequence position certain K A Thu Jul 07 12:18:21 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was lys554glu_ lys555_558ala_lys665glu_lys666_669ala_lys777glu_lys778_781ala Fri Jul 22 10:50:56 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'lys554glu,lys555ala,lys558ala,lys665glu,lys666ala,lys669ala,lys777glu,lys778ala,lys781ala' Wed May 02 17:49:02 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys_lys554-555glu_ala,lys558ala,lys_lys665-666glu_ala,lys669ala,lys_lys777-778glu_ala,lys781ala' Tue Jun 30 16:27:57 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys554_Lys555delinsGluAla;Lys558Ala;Lys665_Lys666delinsGluAla;Lys669Ala;Lys777_Lys778delinsGluAla;Lys781Ala]' physical association physical association Fig. 1C adar-ago2-2 2 9 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 1D Complex further purified by anti-HA coimmunoprecipitation dicer1-adar-4 6 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey 8 unspecified role unspecified role prey prey region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 1E dicer1-adar-5 6 10 unspecified role unspecified role prey prey region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 1E dicer1-adar-6 6 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey physical association physical association Fig. 1F adar-adar 6 8 unspecified role unspecified role prey prey region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined rbd region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Figs. 2D dicer1-adar-7 6 11 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role prey prey region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 2C Complex further purified by anti-HA coimmunoprecipitation adar-dicer1-1 1 11 unspecified role unspecified role neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Supp. Fig. 2D dicer1-pre_let_7a-1 4 12 enzyme target enzyme target substrate substrate unspecified role unspecified role 5-prime region 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 11 enzyme enzyme neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage Supp. Fig. 3, Fig 3A/E. Vmax = 77.3pM/sec adar-dicer1-2 4 11 enzyme enzyme neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 12 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime region 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 8 ancillary ancillary neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage Supp. Fig. 3, Fig 3A, 3E. Vmax = 307.3pM/sec ADAR1 increases the Vmax of the Dicer cleavage of pre-let-7a by 4-fold adar-tarbp2-3 2 7 unspecified role unspecified role prey prey 10 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association Fig. 1Ci adar-dicer1-4 4 10 ancillary ancillary neutral component neutral component spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 12 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime region 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 11 enzyme enzyme neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage Fig 3A ADAR1 increases the Vmax of the Dicer cleavage of pre-let-7a by 4-fold dicer1-ncoa6 4 13 ancillary ancillary neutral component neutral component 11 enzyme enzyme neutral component neutral component region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 12 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime region 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain rna cleavage rna cleavage Fig 3A TRBP increases the Vmax of the Dicer cleavage of pre-let-7a by 4-fold