IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell (0092-8674) 2013 imex curation Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de 17-Jun-2013: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de Accepted 2013-MAY-17 by MGT 17-Jun-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell (0092-8674) 2013 imex curation Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de 17-Jun-2013: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de Accepted 2013-MAY-17 by MGT 17-Jun-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell (0092-8674) 2013 imex curation Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de 17-Jun-2013: Contacted by IntAct-Help. Only protein-protein interactions mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer EMSA (S3E) not done as no sequence Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de Accepted 2013-MAY-17 by MGT 17-Jun-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell (0092-8674) 2013 imex curation Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de 17-Jun-2013: Contacted by IntAct-Help. Only protein-protein interactions mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de Accepted 2013-MAY-17 by MGT 17-Jun-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Intestinal tumorigenesis initiated by dedifferentiation and acquisition of stem-cell-like properties. Cell (0092-8674) 2013 imex curation Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de 17-Jun-2013: Contacted by IntAct-Help. Only protein-protein interactions mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Schwitalla S., Fingerle A.A., Cammareri P., Nebelsiek T., Göktuna S.I., Ziegler P.K., Canli O., Heijmans J., Huels D.J., Moreaux G., Rupec R.A., Gerhard M., Schmid R., Barker N., Clevers H., Lang R., Neumann J., Kirchner T., Taketo M.M., van den Brink G.R., Sansom O.J., Arkan M.C., Greten F.R. Cancer - Interactions investigated in the context of cancer Re-ChIP assay on DNA isolated from IEC of a mouse on day 15 with a beta-catenin antibody for the first precipitation followed by a second immunoprecipitation after DNA isolation with Rela antibody Source of CTNNB1 inferred from previous work of contributing author (Vogelstein B. PMID: 14500351) florian.greten@lrz.tum.de Accepted 2013-MAY-17 by MGT 17-Jun-2013: Contacted by IntAct-Help. Cell (0092-8674) 2013 Only protein-protein interactions imex curation tf65_mouse Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit Rela Nfkb3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein mouse Mus musculus Mouse MDDLFPLIFPSEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGYYEADLCPDRSIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFHVPIEEQRGDYDLNAVRLCFQVTVRDPAGRPLLLTPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFNGPTEPRPPTRRIAVPTRNSTSVPKPAPQPYTFPASLSTINFDEFSPMLLPSGQISNQALALAPSSAPVLAQTMVPSSAMVPLAQPPAPAPVLTPGPPQSLSAPVPKSTQAGEGTLSEALLHLQFDADEDLGALLGNSTDPGVFTDLASVDNSEFQQLLNQGVSMSHSTAEPMLMEYPEAITRLVTGSQRPPDPAPTPLGTSGLPNGLSGDEDFSSIADMDFSALLSQISS DIP protein Q04207 original sequence version: 158 DIP protein Q04207 original sequence version: 117 DIP protein Q04207-1 original sequence version: 117 DIP protein Q04207-1 original sequence version: 118 DIP protein Q04207 original sequence version: 119 DIP protein Q04207 original sequence version: 141 DIP protein Q04207-1 original sequence version: 141 DIP protein Q04207-1 original sequence version: 149 DIP protein Q04207 original sequence version: 149 DIP protein Q04207 original sequence version: 168 DIP protein Q04207 original sequence version: 125 BDF1673D2FE398B9 cbp_mouse Histone lysine acetyltransferase CREBBP Crebbp Cbp Protein-lysine acetyltransferase CREBBP protein protein mouse Mus musculus Mouse MAENLLDGPPNPKRAKLSSPGFSANDNTDFGSLFDLENDLPDELIPNGELSLLNSGNLVPDAASKHKQLSELLRGGSGSSINPGIGNVSASSPVQQGLGGQAQGQPNSTNMASLGAMGKSPLNQGDSSTPNLPKQAASTSGPTPPASQALNPQAQKQVGLVTSSPATSQTGPGICMNANFNQTHPGLLNSNSGHSLMNQAQQGQAQVMNGSLGAAGRGRGAGMPYPAPAMQGATSSVLAETLTQVSPQMAGHAGLNTAQAGGMTKMGMTGTTSPFGQPFSQTGGQQMGATGVNPQLASKQSMVNSLPAFPTDIKNTSVTTVPNMSQLQTSVGIVPTQAIATGPTADPEKRKLIQQQLVLLLHAHKCQRREQANGEVRACSLPHCRTMKNVLNHMTHCQAGKACQVAHCASSRQIISHWKNCTRHDCPVCLPLKNASDKRNQQTILGSPASGIQNTIGSVGAGQQNATSLSNPNPIDPSSMQRAYAALGLPYMNQPQTQLQPQVPGQQPAQPPAHQQMRTLNALGNNPMSIPAGGITTDQQPPNLISESALPTSLGATNPLMNDGSNSGNIGSLSTIPTAAPPSSTGVRKGWHEHVTQDLRSHLVHKLVQAIFPTPDPAALKDRRMENLVAYAKKVEGDMYESANSRDEYYHLLAEKIYKIQKELEEKRRSRLHKQGILGNQPALPASGAQPPVIPPAQSVRPPNGPLPLPVNRMQVSQGMNSFNPMSLGNVQLPQAPMGPRAASPMNHSVQMNSMASVPGMAISPSRMPQPPNMMGTHANNIMAQAPTQNQFLPQNQFPSSSGAMSVNSVGMGQPAAQAGVSQGQVPGAALPNPLNMLAPQASQLPCPPVTQSPLHPTPPPASTAAGMPSLQHPTAPGMTPPQPAAPTQPSTPVSSGQTPTPTPGSVPSAAQTQSTPTVQAAAQAQVTPQPQTPVQPPSVATPQSSQQQPTPVHTQPPGTPLSQAAASIDNRVPTPSSVTSAETSSQQPGPDVPMLEMKTEVQTDDAEPEPTESKGEPRSEMMEEDLQGSSQVKEETDTTEQKSEPMEVEEKKPEVKVEAKEEEENSSNDTASQSTSPSQPRKKIFKPEELRQALMPTLEALYRQDPESLPFRQPVDPQLLGIPDYFDIVKNPMDLSTIKRKLDTGQYQEPWQYVDDVWLMFNNAWLYNRKTSRVYKFCSKLAEVFEQEIDPVMQSLGYCCGRKYEFSPQTLCCYGKQLCTIPRDAAYYSYQNRYHFCEKCFTEIQGENVTLGDDPSQPQTTISKDQFEKKKNDTLDPEPFVDCKECGRKMHQICVLHYDIIWPSGFVCDNCLKKTGRPRKENKFSAKRLQTTRLGNHLEDRVNKFLRRQNHPEAGEVFVRVVASSDKTVEVKPGMKSRFVDSGEMSESFPYRTKALFAFEEIDGVDVCFFGMHVQNTALIAPHQIQGRVYISYLDSIHFFRPRCLRTAVYHEILIGYLEYVKKLGYVTGHIWACPPSEGDDYIFHCHPPDQKIPKPKRLQEWYKKMLDKAFAERIINDYKDIFKQANEDRLTSAKELPYFEGDFWPNVLEESIKELEQEEEERKKEESTAASETPEGSQGDSKNAKKKNNKKTNKNKSSISRANKKKPSMPNVSNDLSQKLYATMEKHKEVFFVIHLHAGPVISTQPPIVDPDPLLSCDLMDGRDAFLTLARDKHWEFSSLRRSKWSTLCMLVELHTQGQDRFVYTCNECKHHVETRWHCTVCEDYDLCINCYNTKSHTHKMVKWGLGLDDEGSSQGEPQSKSPQESRRLSIQRCIQSLVHACQCRNANCSLPSCQKMKRVVQHTKGCKRKTNGGCPVCKQLIALCCYHAKHCQENKCPVPFCLNIKHKLRQQQIQHRLQQAQLMRRRMATMNTRNVPQQSLPSPTSAPPGTPTQQPSTPQTPQPPAQPQPSPVNMSPAGFPNVARTQPPTIVSAGKPTNQVPAPPPPAQPPPAAVEAARQIEREAQQQQHLYRANINNGMPPGRAGMGTPGSQMTPVGLNVPRPNQVSGPVMSSMPPGQWQQAPIPQQQPMPGMPRPVMSMQAQAAVAGPRMPNVQPPRSISPSALQDLLRTLKSPSSPQQQQQVLNILKSNPQLMAAFIKQRTAKYVANQPGMQPQPGLQSQPGMQPQPGMHQQPSLQNLNAMQAGVPRPGVPPPQPAMGGLNPQGQALNIMNPGHNPNMTNMNPQYREMVRRQLLQHQQQQQQQQQQQQQQQNSASLAGGMAGHSQFQQPQGPGGYAPAMQQQRMQQHLPIQGSSMGQMAAPMGQLGQMGQPGLGADSTPNIQQALQQRILQQQQMKQQIGSPGQPNPMSPQQHMLSGQPQASHLPGQQIATSLSNQVRSPAPVQSPRPQSQPPHSSPSPRIQPQPSPHHVSPQTGSPHPGLAVTMASSMDQGHLGNPEQSAMLPQLNTPNRSALSSELSLVGDTTGDTLEKFVEGL DIP protein P45481 original sequence version: 148 DIP protein P45481 original sequence version: 126 DIP protein P45481 original sequence version: 152 DIP protein P45481 original sequence version: 115 DIP protein P45481 original sequence version: 127 DIP protein P45481 original sequence version: 123 DIP protein P45481 original sequence version: 149 DIP protein P45481 original sequence version: 156 DIP protein P45481 original sequence version: 169 DIP protein P45481 original sequence version: 175 DIP protein P45481 original sequence version: 135 D89AF52B7BD33347 tcf_lef binding site oligonucleotide Tcf/Lef binding site oligonucleotide dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CCCTTTGATCTTACCCCCTTTGATCTTACC sox9_mouse_gene Mouse Sox9 gene gene gene mouse Mus musculus Mouse ctnb1_mouse Catenin beta-1 Beta-catenin Ctnnb1 Catnb protein protein mouse Mus musculus Mouse MATQADLMELDMAMEPDRKAAVSHWQQQSYLDSGIHSGATTTAPSLSGKGNPEEEDVDTSQVLYEWEQGFSQSFTQEQVADIDGQYAMTRAQRVRAAMFPETLDEGMQIPSTQFDAAHPTNVQRLAEPSQMLKHAVVNLINYQDDAELATRAIPELTKLLNDEDQVVVNKAAVMVHQLSKKEASRHAIMRSPQMVSAIVRTMQNTNDVETARCTAGTLHNLSHHREGLLAIFKSGGIPALVKMLGSPVDSVLFYAITTLHNLLLHQEGAKMAVRLAGGLQKMVALLNKTNVKFLAITTDCLQILAYGNQESKLIILASGGPQALVNIMRTYTYEKLLWTTSRVLKVLSVCSSNKPAIVEAGGMQALGLHLTDPSQRLVQNCLWTLRNLSDAATKQEGMEGLLGTLVQLLGSDDINVVTCAAGILSNLTCNNYKNKMMVCQVGGIEALVRTVLRAGDREDITEPAICALRHLTSRHQEAEMAQNAVRLHYGLPVVVKLLHPPSHWPLIKATVGLIRNLALCPANHAPLREQGAIPRLVQLLVRAHQDTQRRTSMGGTQQQFVEGVRMEEIVEGCTGALHILARDVHNRIVIRGLNTIPLFVQLLYSPIENIQRVAAGVLCELAQDKEAAEAIEAEGATAPLTELLHSRNEGVATYAAAVLFRMSEDKPQDYKKRLSVELTSSLFRTEPMAWNETADLGLDIGAQGEALGYRQDDPSYRSFHSGGYGQDALGMDPMMEHEMGGHHPGADYPVDGLPDLGHAQDLMDGLPPGDSNQLAWFDTDL DIP protein Q02248 original sequence version: 128 DIP protein Q02248 original sequence version: 135 DIP protein Q02248 original sequence version: 147 DIP protein Q02248 original sequence version: 187 DIP protein Q02248 original sequence version: 140 D708F170A3FBED6E ctnb1_human Catenin beta-1 Beta-catenin OK/SW-cl.35 PRO2286 CTNNB1 CTNNB protein protein human Homo sapiens Human MATQADLMELDMAMEPDRKAAVSHWQQQSYLDSGIHSGATTTAPSLSGKGNPEEEDVDTSQVLYEWEQGFSQSFTQEQVADIDGQYAMTRAQRVRAAMFPETLDEGMQIPSTQFDAAHPTNVQRLAEPSQMLKHAVVNLINYQDDAELATRAIPELTKLLNDEDQVVVNKAAVMVHQLSKKEASRHAIMRSPQMVSAIVRTMQNTNDVETARCTAGTLHNLSHHREGLLAIFKSGGIPALVKMLGSPVDSVLFYAITTLHNLLLHQEGAKMAVRLAGGLQKMVALLNKTNVKFLAITTDCLQILAYGNQESKLIILASGGPQALVNIMRTYTYEKLLWTTSRVLKVLSVCSSNKPAIVEAGGMQALGLHLTDPSQRLVQNCLWTLRNLSDAATKQEGMEGLLGTLVQLLGSDDINVVTCAAGILSNLTCNNYKNKMMVCQVGGIEALVRTVLRAGDREDITEPAICALRHLTSRHQEAEMAQNAVRLHYGLPVVVKLLHPPSHWPLIKATVGLIRNLALCPANHAPLREQGAIPRLVQLLVRAHQDTQRRTSMGGTQQQFVEGVRMEEIVEGCTGALHILARDVHNRIVIRGLNTIPLFVQLLYSPIENIQRVAAGVLCELAQDKEAAEAIEAEGATAPLTELLHSRNEGVATYAAAVLFRMSEDKPQDYKKRLSVELTSSLFRTEPMAWNETADLGLDIGAQGEPLGYRQDDPSYRSFHSGGYGQDALGMDPMMEHEMGGHHPGADYPVDGLPDLGHAQDLMDGLPPGDSNQLAWFDTDL DIP protein P35222 original sequence version: 187 DIP protein P35222 original sequence version: 188 DIP protein P35222 original sequence version: 180 DIP protein P35222-1 original sequence version: 181 DIP protein P35222 original sequence version: 181 DIP protein P35222 original sequence version: 107 DIP protein P35222-1 original sequence version: 107 DIP protein P35222 original sequence version: 103 DIP protein P35222-1 original sequence version: 103 DIP protein P35222 original sequence version: 175 DIP protein P35222 original sequence version: 136 DIP protein P35222 original sequence version: 135 DIP protein P35222 original sequence version: 131 DIP protein P35222-1 original sequence version: 133 DIP protein P35222 original sequence version: 133 DIP protein P35222 original sequence version: 148 DIP protein P35222-1 original sequence version: 139 DIP protein P35222 original sequence version: 139 DIP protein P35222 original sequence version: 146 DIP protein P35222 original sequence version: 196 DIP protein P35222 original sequence version: 192 DIP protein P35222 original sequence version: 185 DIP protein P35222 original sequence version: 151 DIP protein P35222-1 original sequence version: 151 DIP protein P35222-1 original sequence version: 171 DIP protein P35222-1 original sequence version: 148 DIP protein P35222 original sequence version: 177 DIP protein P35222 original sequence version: 178 DIP protein P35222-1 original sequence version: 178 CB78F165A3EEF86E ascl2_mouse_gene Achaete-scute homolog 2 gene gene gene mouse Mus musculus Mouse cbp_human CREB-binding protein CREBBP CBP Histone lysine acetyltransferase CREBBP Protein-lysine acetyltransferase CREBBP protein protein human Homo sapiens Human MAENLLDGPPNPKRAKLSSPGFSANDSTDFGSLFDLENDLPDELIPNGGELGLLNSGNLVPDAASKHKQLSELLRGGSGSSINPGIGNVSASSPVQQGLGGQAQGQPNSANMASLSAMGKSPLSQGDSSAPSLPKQAASTSGPTPAASQALNPQAQKQVGLATSSPATSQTGPGICMNANFNQTHPGLLNSNSGHSLINQASQGQAQVMNGSLGAAGRGRGAGMPYPTPAMQGASSSVLAETLTQVSPQMTGHAGLNTAQAGGMAKMGITGNTSPFGQPFSQAGGQPMGATGVNPQLASKQSMVNSLPTFPTDIKNTSVTNVPNMSQMQTSVGIVPTQAIATGPTADPEKRKLIQQQLVLLLHAHKCQRREQANGEVRACSLPHCRTMKNVLNHMTHCQAGKACQVAHCASSRQIISHWKNCTRHDCPVCLPLKNASDKRNQQTILGSPASGIQNTIGSVGTGQQNATSLSNPNPIDPSSMQRAYAALGLPYMNQPQTQLQPQVPGQQPAQPQTHQQMRTLNPLGNNPMNIPAGGITTDQQPPNLISESALPTSLGATNPLMNDGSNSGNIGTLSTIPTAAPPSSTGVRKGWHEHVTQDLRSHLVHKLVQAIFPTPDPAALKDRRMENLVAYAKKVEGDMYESANSRDEYYHLLAEKIYKIQKELEEKRRSRLHKQGILGNQPALPAPGAQPPVIPQAQPVRPPNGPLSLPVNRMQVSQGMNSFNPMSLGNVQLPQAPMGPRAASPMNHSVQMNSMGSVPGMAISPSRMPQPPNMMGAHTNNMMAQAPAQSQFLPQNQFPSSSGAMSVGMGQPPAQTGVSQGQVPGAALPNPLNMLGPQASQLPCPPVTQSPLHPTPPPASTAAGMPSLQHTTPPGMTPPQPAAPTQPSTPVSSSGQTPTPTPGSVPSATQTQSTPTVQAAAQAQVTPQPQTPVQPPSVATPQSSQQQPTPVHAQPPGTPLSQAAASIDNRVPTPSSVASAETNSQQPGPDVPVLEMKTETQAEDTEPDPGESKGEPRSEMMEEDLQGASQVKEETDIAEQKSEPMEVDEKKPEVKVEVKEEEESSSNGTASQSTSPSQPRKKIFKPEELRQALMPTLEALYRQDPESLPFRQPVDPQLLGIPDYFDIVKNPMDLSTIKRKLDTGQYQEPWQYVDDVWLMFNNAWLYNRKTSRVYKFCSKLAEVFEQEIDPVMQSLGYCCGRKYEFSPQTLCCYGKQLCTIPRDAAYYSYQNRYHFCEKCFTEIQGENVTLGDDPSQPQTTISKDQFEKKKNDTLDPEPFVDCKECGRKMHQICVLHYDIIWPSGFVCDNCLKKTGRPRKENKFSAKRLQTTRLGNHLEDRVNKFLRRQNHPEAGEVFVRVVASSDKTVEVKPGMKSRFVDSGEMSESFPYRTKALFAFEEIDGVDVCFFGMHVQEYGSDCPPPNTRRVYISYLDSIHFFRPRCLRTAVYHEILIGYLEYVKKLGYVTGHIWACPPSEGDDYIFHCHPPDQKIPKPKRLQEWYKKMLDKAFAERIIHDYKDIFKQATEDRLTSAKELPYFEGDFWPNVLEESIKELEQEEEERKKEESTAASETTEGSQGDSKNAKKKNNKKTNKNKSSISRANKKKPSMPNVSNDLSQKLYATMEKHKEVFFVIHLHAGPVINTLPPIVDPDPLLSCDLMDGRDAFLTLARDKHWEFSSLRRSKWSTLCMLVELHTQGQDRFVYTCNECKHHVETRWHCTVCEDYDLCINCYNTKSHAHKMVKWGLGLDDEGSSQGEPQSKSPQESRRLSIQRCIQSLVHACQCRNANCSLPSCQKMKRVVQHTKGCKRKTNGGCPVCKQLIALCCYHAKHCQENKCPVPFCLNIKHKLRQQQIQHRLQQAQLMRRRMATMNTRNVPQQSLPSPTSAPPGTPTQQPSTPQTPQPPAQPQPSPVSMSPAGFPSVARTQPPTTVSTGKPTSQVPAPPPPAQPPPAAVEAARQIEREAQQQQHLYRVNINNSMPPGRTGMGTPGSQMAPVSLNVPRPNQVSGPVMPSMPPGQWQQAPLPQQQPMPGLPRPVISMQAQAAVAGPRMPSVQPPRSISPSALQDLLRTLKSPSSPQQQQQVLNILKSNPQLMAAFIKQRTAKYVANQPGMQPQPGLQSQPGMQPQPGMHQQPSLQNLNAMQAGVPRPGVPPQQQAMGGLNPQGQALNIMNPGHNPNMASMNPQYREMLRRQLLQQQQQQQQQQQQQQQQQQGSAGMAGGMAGHGQFQQPQGPGGYPPAMQQQQRMQQHLPLQGSSMGQMAAQMGQLGQMGQPGLGADSTPNIQQALQQRILQQQQMKQQIGSPGQPNPMSPQQHMLSGQPQASHLPGQQIATSLSNQVRSPAPVQSPRPQSQPPHSSPSPRIQPQPSPHHVSPQTGSPHPGLAVTMASSIDQGHLGNPEQSAMLPQLNTPSRSALSSELSLVGDTTGDTLEKFVEGL DIP protein Q92793 original sequence version: 134 DIP protein Q92793-1 original sequence version: 171 DIP protein Q92793 original sequence version: 171 DIP protein Q92793 original sequence version: 185 DIP protein Q92793 original sequence version: 106 DIP protein Q92793 original sequence version: 104 DIP protein Q92793 original sequence version: 112 DIP protein Q92793 original sequence version: 135 DIP protein Q92793 original sequence version: 139 DIP protein Q92793 original sequence version: 157 DIP protein Q92793 original sequence version: 177 DIP protein Q92793 original sequence version: 168 DIP protein Q92793-1 original sequence version: 174 DIP protein Q92793 original sequence version: 146 DIP protein Q92793 original sequence version: 161 DIP protein Q92793 original sequence version: 172 3BEA9B8558BA1A5E tf65_human Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit RELA NFKB3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein human Homo sapiens Human MDELFPLIFPAEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGFYEAELCPDRCIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFQVPIEEQRGDYDLNAVRLCFQVTVRDPSGRPLRLPPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFSGPTDPRPPPRRIAVPSRSSASVPKPAPQPYPFTSSLSTINYDEFPTMVFPSGQISQASALAPAPPQVLPQAPAPAPAPAMVSALAQAPAPVPVLAPGPPQAVAPPAPKPTQAGEGTLSEALLQLQFDDEDLGALLGNSTDPAVFTDLASVDNSEFQQLLNQGIPVAPHTTEPMLMEYPEAITRLVTGAQRPPDPAPAPLGAPGLPNGLLSGDEDFSSIADMDFSALLSQISS DIP protein Q04206 original sequence version: 170 DIP protein Q04206 original sequence version: 173 DIP protein Q04206 original sequence version: 99 DIP protein Q04206-1 original sequence version: 99 DIP protein Q04206 original sequence version: 168 DIP protein Q04206 original sequence version: 128 DIP protein Q04206 original sequence version: 131 DIP protein Q04206 original sequence version: 153 DIP protein Q04206 original sequence version: 185 DIP protein Q04206 original sequence version: 181 DIP protein Q04206 original sequence version: 183 8147A6AF9F2445C6 itf2_human Transcription factor 4 Immunoglobulin transcription factor 2 SL3-3 enhancer factor 2 ITF2 SEF2 TCF4 BHLHB19 Class B basic helix-loop-helix protein 19 protein protein human Homo sapiens Human MHHQQRMAALGTDKELSDLLDFSAMFSPPVSSGKNGPTSLASGHFTGSNVEDRSSSGSWGNGGHPSPSRNYGDGTPYDHMTSRDLGSHDNLSPPFVNSRIQSKTERGSYSSYGRESNLQGCHQQSLLGGDMDMGNPGTLSPTKPGSQYYQYSSNNPRRRPLHSSAMEVQTKKVRKVPPGLPSSVYAPSASTADYNRDSPGYPSSKPATSTFPSSFFMQDGHHSSDPWSSSSGMNQPGYAGMLGNSSHIPQSSSYCSLHPHERLSYPSHSSADINSSLPPMSTFHRSGTNHYSTSSCTPPANGTDSIMANRGSGAAGSSQTGDALGKALASIYSPDHTNNSFSSNPSTPVGSPPSLSAGTAVWSRNGGQASSSPNYEGPLHSLQSRIEDRLERLDDAIHVLRNHAVGPSTAMPGGHGDMHGIIGPSHNGAMGGLGSGYGTGLLSANRHSLMVGTHREDGVALRGSHSLLPNQVPVPQLPVQSATSPDLNPPQDPYRGMPPGLQGQSVSSGSSEIKSDDEGDENLQDTKSSEDKKLDDDKKDIKSITSNNDDEDLTPEQKAEREKERRMANNARERLRVRDINEAFKELGRMVQLHLKSDKPQTKLLILHQAVAVILSLEQQVRERNLNPKAACLKRREEEKVSSEPPPLSLAGPHPGMGDASNHMGQM DIP protein P15884 original sequence version: 159 DIP protein P15884 original sequence version: 93 DIP protein P15884 original sequence version: 116 53459FC7989D9487 lgr5_mouse_gene Leucine-rich repeat-containing G-protein coupled receptor 5 gene gene gene mouse Mus musculus Mouse ctnnb1-rela 3 10 unspecified role unspecified role bait bait 6 unspecified role unspecified role prey prey physical association physical association Fig. 3A The interaction was strongly enhanced when beta-catenin was stably expressed. rela-ctnnb1 3 6 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association Fig. 3A The interaction was strongly enhanced when beta-catenin was stably expressed. tcf-ctnnb1-4 2 11 unspecified role unspecified role prey prey P35222:p.Ser33Tyr mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 17:55:47 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 20:15:33 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] 8 unspecified role unspecified role bait bait 5-prime region biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3B Stabilization of beta-catenin strongly induced its binding to DNA. This was greatly diminished in the absence of RelA/p65. TNFalpha could increase binding of β-catenin to the Tcf/Lef motif in 293 cells that had been transfected with a Ser33Tyr mutant of β-catenin ctnnb1-rela-1 4 16 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait association association Fig. 3C ctnnb1-ascl2 4 10 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3C ctnnb1-sox9 4 10 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3C rela-lgr5 5 6 unspecified role unspecified role bait bait 16 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role prey prey association association Fig. 3D ctnnb1-lgr5 4 10 unspecified role unspecified role bait bait 16 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3C rela-ascl2-2 5 12 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait association association Fig. 3D rela-ascl2-1 4 6 unspecified role unspecified role bait bait 12 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3C rela-sox9 5 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role prey prey association association Fig. 3D rela-sox9-1 4 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter_ctnnb1/tcf_consensus_motif region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3C tcf-ctnnb1-6 2 15 unspecified role unspecified role prey prey human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. 11 unspecified role unspecified role prey prey P35222:p.Ser33Tyr mutation mutation certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 15:58:04 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 16:43:49 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. 8 unspecified role unspecified role bait bait 5-prime region biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) association association Fig. 3F IKBKB (constitutively active form) NF-kappa-B activation rela-ctnnb1 1 11 unspecified role unspecified role prey prey P35222:p.Ser33Tyr mutation mutation certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 17:48:52 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 17:14:05 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' 14 unspecified role unspecified role bait bait physical association physical association Fig. 3G a constitutively active form of IKKβ (IKKβEE) ctnnb1-rela-2 1 14 unspecified role unspecified role prey prey 11 unspecified role unspecified role bait bait P35222:p.Ser33Tyr mutation mutation certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 19:14:29 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 18:44:13 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' physical association physical association Fig. 3F a constitutively active form of IKKβ (IKKβEE) crebbp-ctnnb1-4 1 13 unspecified role unspecified role bait bait 11 unspecified role unspecified role prey prey P35222:p.Ser33Tyr mutation mutation certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 19:25:53 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 16:32:38 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' physical association physical association Fig. 3F a constitutively active form of IKKβ (IKKβEE) crebbp-ctnnb1-5 3 7 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association Fig. 4C NF-kappa-B activation tcf-ctnnb1-5 2 8 unspecified role unspecified role bait bait 5-prime region biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role prey prey P35222:p.Ser33Tyr mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S Y Wed May 02 15:32:36 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'ser33tyr' Tue Jun 30 16:51:49 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Ser33Tyr' human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. physical association physical association Fig. 3E Stabilization of beta-catenin strongly induced its binding to DNA. This was greatly diminished in the absence of RelA/p65. TNFalpha could increase binding of β-catenin to the Tcf/Lef motif in 293 cells that had been transfected with a Ser33Tyr mutant of β-catenin tcf-ctnnb1-7 2 8 unspecified role unspecified role bait bait 5-prime region biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role prey prey mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] 10 unspecified role unspecified role prey prey mouse-epithelium Mus musculus epithelium Epithelium [epithelial cells] association association Fig. 4C NF-kappa-B activation