IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. J. Biol. Chem. (0021-9258) 2009 imex curation Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr 18-Dec-2012: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column weight by comassie molecular weight estimation by coomasie staining weight by comassie Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr Accepted 2012-DEC-14 by ORCHARD 18-Dec-2012: Contacted by IntAct-Help. J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. J. Biol. Chem. (0021-9258) 2009 imex curation Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr 18-Dec-2012: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr Accepted 2012-DEC-14 by ORCHARD 18-Dec-2012: Contacted by IntAct-Help. J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. Anti-activator ExsD forms a 1:1 complex with ExsA to inhibit transcription of type III secretion operons. J. Biol. Chem. (0021-9258) 2009 imex curation Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr 18-Dec-2012: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column anti tag western anti tag western blot anti tag western Thibault J., Faudry E., Ebel C., Attree I., Elsen S. sylvie.elsen@cea.fr Accepted 2012-DEC-14 by ORCHARD 18-Dec-2012: Contacted by IntAct-Help. J. Biol. Chem. (0021-9258) 2009 Only protein-protein interactions imex curation exsceba promoter promoter of exsCEBA operon dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid pseai Pseudomonas aeruginosa GCGATGTGGCTTTTTTCTTAAAAGAAAAGTCTCTCAGTGACAAAAGCGATGCATAGCCCG p95429_pseai exsD E4V10_00450 PAMH19_5053 ECC04_020105 IPC1316_11625 IPC1339_18030 IPC614_16225 IPC1295_05320 IPC1323_11550 protein protein pseai Pseudomonas aeruginosa MEQEDDKQYSREAVFAGRRVSVVGSDARSRGRVPGYASSSLYRESGIISARQLALLQRMLPRLRLEQLFRCEWLQQRLARGLALGREEVRQILLCAAQDDDGWCAELGDRVNLAVPQSMIDWVLLPVYGWWESLLDQAIPGWRLSLVELETQSRQLRVKSEFWSRVAELEPEQAREELARVAKCQARTQEQVAELAGKLETASALAKSAWPNWQRGMATLLASGGLAGFEPIPEVLECLWQPLCRLDDDVGAADAVQAWLHERNLCQAQDHFYWQS E93A868DEE28C171 j7dcm5_pseai exsA PACIG1_3608 protein protein pseudomonas aeruginosa cig1 Pseudomonas aeruginosa CIG1 MQGAKSLGRKQITSCHWNIPTFEYRVNKEEGVYVLLEGELTVQDIDSTFCLAPGELLFVRRGSYVVSTKGKDSRILWIPLSAQFLQGFVQRFGALLSEVERCDEPVPGIIAFAATPLLAGCVKGLKELLVHEHPPMLACLKIEELLMLFAFSPQGPLLMSVLRQLSNRHVERLQLFMEKHYLNEWKLSDFSREFGMGLTTFKELFGSVYGVSPRAWISERRILYAHQLLLNSDMSIVDIAMEAGFSSQSYFTQSYRRRFGCTPSRSRQGKDECRAKNN The sequence has been withdrawn from uniprot. 4823D0E9135E0BB7 exsceba_promote-exsa 2 6 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role bait bait direct interaction direct interaction Figure 5B exsceba_promo-exsa-1 2 4 unspecified role unspecified role bait bait 6 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role prey prey ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5C exsa-exsa 3 6 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role neutral component neutral component direct interaction direct interaction Figure 6 exsa-exsceba_promote 1 6 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 4 unspecified role unspecified role neutral component neutral component 5 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) physical association physical association Figure 3C exsceba_promo-exsa-2 2 4 unspecified role unspecified role bait bait 6 unspecified role unspecified role prey prey histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 5A exsa-exsceba_promo-1 1 5 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component histag his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Figure 3C