MINT MINT, Dpt of Biology, University of Rome Tor Vergata MINT http://mint.bio.uniroma2.it/mint url>http://mint.bio.uniroma2.it/mint/ https://mint.bio.uniroma2.it MINT-[0-9]+ https://mint.bio.uniroma2.it/index.php/results-interactions/?id=${ac} The Molecular INTeraction database (MINT) is a relational database designed to store interactions between biological molecules. http://mint.bio.uniroma2.it Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. J. Biol. Chem. (0021-9258) 1996 Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 PMID_in_GD partial coverage rapid curation in vitro In vitro competition binding competition binding predetermined predetermined participant predetermined Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 PMID_in_GD PMID_in_GD J. Biol. Chem. (0021-9258) 1996 partial coverage rapid curation Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. Differential activation of acute phase response factor/STAT3 and STAT1 via the cytoplasmic domain of the interleukin 6 signal transducer gp130. I. Definition of a novel phosphotyrosine motif mediating STAT1 activation. J. Biol. Chem. (0021-9258) 1996 Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 PMID_in_GD partial coverage rapid curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Gerhartz C., Heesel B., Sasse J., Hemmann U., Landgraf C., Schneider-Mergener J., Horn F., Heinrich PC., Graeve L. SH2 PMID_in_GD J. Biol. Chem. (0021-9258) 1996 partial coverage rapid curation il6rb_human Interleukin-6 receptor subunit beta IL6ST Interleukin-6 signal transducer Membrane glycoprotein 130 CDw130 Oncostatin-M receptor subunit alpha protein protein human Homo sapiens Human MLTLQTWLVQALFIFLTTESTGELLDPCGYISPESPVVQLHSNFTAVCVLKEKCMDYFHVNANYIVWKTNHFTIPKEQYTIINRTASSVTFTDIASLNIQLTCNILTFGQLEQNVYGITIISGLPPEKPKNLSCIVNEGKKMRCEWDGGRETHLETNFTLKSEWATHKFADCKAKRDTPTSCTVDYSTVYFVNIEVWVEAENALGKVTSDHINFDPVYKVKPNPPHNLSVINSEELSSILKLTWTNPSIKSVIILKYNIQYRTKDASTWSQIPPEDTASTRSSFTVQDLKPFTEYVFRIRCMKEDGKGYWSDWSEEASGITYEDRPSKAPSFWYKIDPSHTQGYRTVQLVWKTLPPFEANGKILDYEVTLTRWKSHLQNYTVNATKLTVNLTNDRYLATLTVRNLVGKSDAAVLTIPACDFQATHPVMDLKAFPKDNMLWVEWTTPRESVKKYILEWCVLSDKAPCITDWQQEDGTVHRTYLRGNLAESKCYLITVTPVYADGPGSPESIKAYLKQAPPSKGPTVRTKKVGKNEAVLEWDQLPVDVQNGFIRNYTIFYRTIIGNETAVNVDSSHTEYTLSSLTSDTLYMVRMAAYTDEGGKDGPEFTFTTPKFAQGEIEAIVVPVCLAFLLTTLLGVLFCFNKRDLIKKHIWPNVPDPSKSHIAQWSPHTPPRHNFNSKDQMYSDGNFTDVSVVEIEANDKKPFPEDLKSLDLFKKEKINTEGHSSGIGGSSCMSSSRPSISSSDENESSQNTSSTVQYSTVVHSGYRHQVPSVQVFSRSESTQPLLDSEERPEDLQLVDHVDGGDGILPRQQYFKQNCSQHESSPDISHFERSKQVSSVNEEDFVRLKQQISDHISQSCGSGQMKMFQEVSAADAFGPGTEGQVERFETVGMEAATDEGMPKSYLPQTVRQGGYMPQ 6510A4409FFCF08C c-fos promoter region SIE-oligonucleotide from the c-fos promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GATCCGGGAGGGATTTACGGGGAAATGCTG stat1_human Signal transducer and activator of transcription 1-alpha/beta STAT1 Transcription factor ISGF-3 components p91/p84 protein protein human Homo sapiens Human MSQWYELQQLDSKFLEQVHQLYDDSFPMEIRQYLAQWLEKQDWEHAANDVSFATIRFHDLLSQLDDQYSRFSLENNFLLQHNIRKSKRNLQDNFQEDPIQMSMIIYSCLKEERKILENAQRFNQAQSGNIQSTVMLDKQKELDSKVRNVKDKVMCIEHEIKSLEDLQDEYDFKCKTLQNREHETNGVAKSDQKQEQLLLKKMYLMLDNKRKEVVHKIIELLNVTELTQNALINDELVEWKRRQQSACIGGPPNACLDQLQNWFTIVAESLQQVRQQLKKLEELEQKYTYEHDPITKNKQVLWDRTFSLFQQLIQSSFVVERQPCMPTHPQRPLVLKTGVQFTVKLRLLVKLQELNYNLKVKVLFDKDVNERNTVKGFRKFNILGTHTKVMNMEESTNGSLAAEFRHLQLKEQKNAGTRTNEGPLIVTEELHSLSFETQLCQPGLVIDLETTSLPVVVISNVSQLPSGWASILWYNMLVAEPRNLSFFLTPPCARWAQLSEVLSWQFSSVTKRGLNVDQLNMLGEKLLGPNASPDGLIPWTRFCKENINDKNFPFWLWIESILELIKKHLLPLWNDGCIMGFISKERERALLKDQQPGTFLLRFSESSREGAITFTWVERSQNGGEPDFHAVEPYTKKELSAVTFPDIIRNYKVMAAENIPENPLKYLYPNIDKDHAFGKYYSRPKEAPEPMELDGPKGTGYIKTELISVSEVHPSRLQTTDNLLPMSPEEFDEVSRIVGSVEFDSMMNTV 054A813522364BA6 stat3_mouse Signal transducer and activator of transcription 3 Acute-phase response factor Stat3 Aprf protein protein mouse Mus musculus Mouse MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMDLTSECATSPM DIP protein P42227 original sequence version: 169 DIP protein P42227 original sequence version: 162 DIP protein P42227 original sequence version: 164 DIP protein P42227 original sequence version: 141 6C00626711C8012D stat3_human Signal transducer and activator of transcription 3 Acute-phase response factor STAT3 APRF protein protein human Homo sapiens Human MAQWNQLQQLDTRYLEQLHQLYSDSFPMELRQFLAPWIESQDWAYAASKESHATLVFHNLLGEIDQQYSRFLQESNVLYQHNLRRIKQFLQSRYLEKPMEIARIVARCLWEESRLLQTAATAAQQGGQANHPTAAVVTEKQQMLEQHLQDVRKRVQDLEQKMKVVENLQDDFDFNYKTLKSQGDMQDLNGNNQSVTRQKMQQLEQMLTALDQMRRSIVSELAGLLSAMEYVQKTLTDEELADWKRRQQIACIGGPPNICLDRLENWITSLAESQLQTRQQIKKLEELQQKVSYKGDPIVQHRPMLEERIVELFRNLMKSAFVVERQPCMPMHPDRPLVIKTGVQFTTKVRLLVKFPELNYQLKIKVCIDKDSGDVAALRGSRKFNILGTNTKVMNMEESNNGSLSAEFKHLTLREQRCGNGGRANCDASLIVTEELHLITFETEVYHQGLKIDLETHSLPVVVISNICQMPNAWASILWYNMLTNNPKNVNFFTKPPIGTWDQVAEVLSWQFSSTTKRGLSIEQLTTLAEKLLGPGVNYSGCQITWAKFCKENMAGKGFSFWVWLDNIIDLVKKYILALWNEGYIMGFISKERERAILSTKPPGTFLLRFSESSKEGGVTFTWVEKDISGKTQIQSVEPYTKQQLNNMSFAEIIMGYKIMDATNILVSPLVYLYPDIPKEEAFGKYCRPESQEHPEADPGSAAPYLKTKFICVTPTTCSNTIDLPMSPRTLDSLMQFGNNGEGAEPSAGGQFESLTFDMELTSECATSPM 6C00632211C8012D DIP protein P40763 original sequence version: 157 DIP protein P40763-1 original sequence version: 147 DIP protein P40763-1 original sequence version: 135 DIP protein P40763-1 original sequence version: 157 DIP protein P40763 original sequence version: 165 DIP protein P40763 original sequence version: 182 DIP protein P40763 original sequence version: 135 6C00632211C8012D ingr1_human Interferon gamma receptor 1 IFNGR1 CDw119 Interferon gamma receptor alpha-chain protein protein human Homo sapiens Human MALLFLLPLVMQGVSRAEMGTADLGPSSVPTPTNVTIESYNMNPIVYWEYQIMPQVPVFTVEVKNYGVKNSEWIDACINISHHYCNISDHVGDPSNSLWVRVKARVGQKESAYAKSEEFAVCRDGKIGPPKLDIRKEEKQIMIDIFHPSVFVNGDEQEVDYDPETTCYIRVYNVYVRMNGSEIQYKILTQKEDDCDEIQCQLAIPVSSLNSQYCVSAEGVLHVWGVTTEKSKEVCITIFNSSIKGSLWIPVVAALLLFLVLSLVFICFYIKKINPLKEKSIILPKSLISVVRSATLETKPESKYVSLITSYQPFSLEKEVVCEEPLSPATVPGMHTEDNPGKVEHTEELSSITEVVTTEENIPDVVPGSHLTPIERESSSPLSSNQSEPGSIALNSYHSRNCSESDHSRNGFDTDSSCLESHSSLSDSEFPPNNKGEIKTEGQELITVIKAPTSFGYDKPHVLVDLLVDDSGKESLIGYRPTEDSKEFS DIP protein P15260 original sequence version: 183 DCF9E574D8F47400 c_fos_promoter_region-ifngr1 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT3_MOUSE 6 unspecified role unspecified role unspecified role unspecified role INGR1_HUMAN 8 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association homomint mint Fig. 3 ifngr1-stat3-1 1 STAT3_MOUSE 6 unspecified role unspecified role unspecified role unspecified role INGR1_HUMAN 8 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association homomint mint c_fos_promoter_region-ifngr1-1 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT1_HUMAN 5 unspecified role unspecified role prey prey INGR1_HUMAN 8 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association Fig. 3 ifngr1-stat1-4 1 INGR1_HUMAN 8 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain STAT1_HUMAN 5 unspecified role unspecified role unspecified role unspecified role association association homomint mint c_fos_promoter_region-il6st 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT3_MOUSE 6 unspecified role unspecified role prey prey IL6RB_HUMAN 3 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association homomint mint Fig. 3 il6st-stat3-3 1 IL6RB_HUMAN 3 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain STAT3_MOUSE 6 unspecified role unspecified role unspecified role unspecified role association association homomint mint c_fos_promoter_region-il6st-1 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT1_HUMAN 5 unspecified role unspecified role prey prey IL6RB_HUMAN 3 unspecified role unspecified role prey prey phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain physical association physical association homomint mint Fig. 3 il6st-stat1-1 1 IL6RB_HUMAN 3 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain STAT1_HUMAN 5 unspecified role unspecified role unspecified role unspecified role association association homomint mint c_fos_promoter_region-il6st-2 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT3_MOUSE 6 unspecified role unspecified role prey prey IL6RB_HUMAN 3 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain physical association physical association homomint mint Fig. 3 il6st-stat3-5 1 STAT3_MOUSE 6 unspecified role unspecified role unspecified role unspecified role IL6RB_HUMAN 3 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association homomint mint c_fos_promoter_region-stat3 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT3_HUMAN 7 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain STAT3_MOUSE 6 unspecified role unspecified role prey prey physical association physical association homomint mint Fig. 3 stat3-stat3-3 1 STAT3_MOUSE 6 unspecified role unspecified role unspecified role unspecified role STAT3_HUMAN 7 unspecified role unspecified role unspecified role unspecified role binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain association association homomint mint c_fos_promoter_region-stat1 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined STAT3_HUMAN 7 unspecified role unspecified role prey prey binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain STAT1_HUMAN 5 unspecified role unspecified role prey prey association association homomint mint Fig. 3 stat1-stat3-2 1 STAT1_HUMAN 5 unspecified role unspecified role unspecified role unspecified role STAT3_HUMAN 7 unspecified role unspecified role unspecified role unspecified role phosphorylated phosphorylated residue phosres phosphorylated residue PhosRes Phospho Phosphorylation Phosphorylation (O of Serine, Threonine, Tyrosine and Aspartate, N epsilon of Lysine) certain certain sequence position certain certain certain sequence position certain binding site binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain association association homomint mint