IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Structural basis of UV DNA-damage recognition by the DDB1-DDB2 complex. Structural basis of UV DNA-damage recognition by the DDB1-DDB2 complex. Cell (0092-8674) 2008 imex curation Scrima A., Konickova R., Czyzewski BK., Kawasaki Y., Jeffrey PD., Groisman R., Nakatani Y., Iwai S., Pavletich NP., Thoma NH. I've not tried to describe the crystal binding the DNA with the pyrimidine-pyrimidone dimer in as I don't know the sequence of the DNA its inserted in, or a sensible way to represent it, even if I did. pavletin@mskcc.org, nicolas.thoma@fmi.ch 09-April-2009: Contacted by JYOTI. jyoti Only protein-protein interactions 3 in vitro In vitro pull down pull down weight by comassie molecular weight estimation by coomasie staining weight by comassie Scrima A., Konickova R., Czyzewski BK., Kawasaki Y., Jeffrey PD., Groisman R., Nakatani Y., Iwai S., Pavletich NP., Thoma NH. I've not tried to describe the crystal binding the DNA with the pyrimidine-pyrimidone dimer in as I don't know the sequence of the DNA its inserted in, or a sensible way to represent it, even if I did. Pulldown experiments also describe DDB1 binding to a human HBV-X protein - this was impossible to unambiguously ascribe to a gene product so the interaction was not curated. pavletin@mskcc.org, nicolas.thoma@fmi.ch Accepted 2009-MAR-23 by JYOTI. 09-April-2009: Contacted by JYOTI. Cell (0092-8674) 2008 jyoti Only protein-protein interactions 3 imex curation Structural basis of UV DNA-damage recognition by the DDB1-DDB2 complex. Structural basis of UV DNA-damage recognition by the DDB1-DDB2 complex. Cell (0092-8674) 2008 imex curation Scrima A., Konickova R., Czyzewski BK., Kawasaki Y., Jeffrey PD., Groisman R., Nakatani Y., Iwai S., Pavletich NP., Thoma NH. I've not tried to describe the crystal binding the DNA with the pyrimidine-pyrimidone dimer in as I don't know the sequence of the DNA its inserted in, or a sensible way to represent it, even if I did. pavletin@mskcc.org, nicolas.thoma@fmi.ch 09-April-2009: Contacted by JYOTI. jyoti Only protein-protein interactions 3 in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Scrima A., Konickova R., Czyzewski BK., Kawasaki Y., Jeffrey PD., Groisman R., Nakatani Y., Iwai S., Pavletich NP., Thoma NH. I've not tried to describe the crystal binding the DNA with the pyrimidine-pyrimidone dimer in as I don't know the sequence of the DNA its inserted in, or a sensible way to represent it, even if I did. pavletin@mskcc.org, nicolas.thoma@fmi.ch Accepted 2009-MAR-23 by JYOTI. 09-April-2009: Contacted by JYOTI. Cell (0092-8674) 2008 jyoti Only protein-protein interactions 3 imex curation ddb2_danre DNA damage-binding protein 2 ddb2 Damage-specific DNA-binding protein 2 si:dkey-45f10.3 protein protein danre Danio rerio (Zebrafish) Brachydanio rerio Zebrafish MARGRAQTDSAASKQTKTVNSKKRPNEETPQPSTKKLKAKQQHKSKQKEETYIQASVKWTGGQKKVGQTSILHYIYKSSLGQSIHAQLRQCLQEPFIRSLKSYKLHRTASPFDRRVTSLEWHPTHPTTVAVGSKGGDIILWDYDVLNKTSFIQGMGPGDAITGMKFNQFNTNQLFVSSIWGATTLRDFSGSVIQVFAKTDSWDYWYCCVDVSVSRQMLATGDSTGRLLLLGLDGHEIFKEKLHKAKVTHAEFNPRCDWLMATSSVDATVKLWDLRNIKDKNSYIAEMPHEKPVNAAYFNPTDSTKLLTTDQRNEIRVYSSYDWSKPDQIIIHPHRQFQHLTPIKATWHPMYDLIVAGRYPDDQLLLNDKRTIDIYDANSGGLVHQLRDPNAAGIISLNKFSPTGDVLASGMGFNILIWNREDTLSSVNRKQTIVTGEDVGGRAGGSRSQRSSQQRPSRDRRAAADEAKLKKKLSATETKSKTKSKTESKTSKSKKK DIP protein Q2YDS1 original sequence version: 75 0B4435B115B15D9D ddb1_human DNA damage-binding protein 1 DDB1 Damage-specific DNA-binding protein 1 UV-damaged DNA-binding factor DDB p127 subunit DNA damage-binding protein a UV-damaged DNA-binding protein 1 Xeroderma pigmentosum group E-complementing protein XPE-binding factor HBV X-associated protein 1 XAP1 protein protein human Homo sapiens Human MSYNYVVTAQKPTAVNGCVTGHFTSAEDLNLLIAKNTRLEIYVVTAEGLRPVKEVGMYGKIAVMELFRPKGESKDLLFILTAKYNACILEYKQSGESIDIITRAHGNVQDRIGRPSETGIIGIIDPECRMIGLRLYDGLFKVIPLDRDNKELKAFNIRLEELHVIDVKFLYGCQAPTICFVYQDPQGRHVKTYEVSLREKEFNKGPWKQENVEAEASMVIAVPEPFGGAIIIGQESITYHNGDKYLAIAPPIIKQSTIVCHNRVDPNGSRYLLGDMEGRLFMLLLEKEEQMDGTVTLKDLRVELLGETSIAECLTYLDNGVVFVGSRLGDSQLVKLNVDSNEQGSYVVAMETFTNLGPIVDMCVVDLERQGQGQLVTCSGAFKEGSLRIIRNGIGIHEHASIDLPGIKGLWPLRSDPNRETDDTLVLSFVGQTRVLMLNGEEVEETELMGFVDDQQTFFCGNVAHQQLIQITSASVRLVSQEPKALVSEWKEPQAKNISVASCNSSQVVVAVGRALYYLQIHPQELRQISHTEMEHEVACLDITPLGDSNGLSPLCAIGLWTDISARILKLPSFELLHKEMLGGEIIPRSILMTTFESSHYLLCALGDGALFYFGLNIETGLLSDRKKVTLGTQPTVLRTFRSLSTTNVFACSDRPTVIYSSNHKLVFSNVNLKEVNYMCPLNSDGYPDSLALANNSTLTIGTIDEIQKLHIRTVPLYESPRKICYQEVSQCFGVLSSRIEVQDTSGGTTALRPSASTQALSSSVSSSKLFSSSTAPHETSFGEEVEVHNLLIIDQHTFEVLHAHQFLQNEYALSLVSCKLGKDPNTYFIVGTAMVYPEEAEPKQGRIVVFQYSDGKLQTVAEKEVKGAVYSMVEFNGKLLASINSTVRLYEWTTEKELRTECNHYNNIMALYLKTKGDFILVGDLMRSVLLLAYKPMEGNFEEIARDFNPNWMSAVEILDDDNFLGAENAFNLFVCQKDSAATTDEERQHLQEVGLFHLGEFVNVFCHGSLVMQNLGETSTPTQGSVLFGTVNGMIGLVTSLSESWYNLLLDMQNRLNKVIKSVGKIEHSFWRSFHTERKTEPATGFIDGDLIESFLDISRPKMQEVVANLQYDDGSGMKREATADDLIKVVEELTRIH DIP protein Q16531 original sequence version: 145 DIP protein Q16531 original sequence version: 140 DIP protein Q16531 original sequence version: 99 DIP protein Q16531 original sequence version: 93 DIP protein Q16531 original sequence version: 116 DIP protein Q16531 original sequence version: 111 DIP protein Q16531-1 original sequence version: 163 DIP protein Q16531 original sequence version: 162 DIP protein Q16531 original sequence version: 113 DIP protein Q16531 original sequence version: 132 DIP protein Q16531 original sequence version: 139 DIP protein Q16531 original sequence version: 151 DIP protein Q16531-1 original sequence version: 144 DIP protein Q16531 original sequence version: 155 74D082023E3D846D damaged dna 5'-AAGTCCTGAATGAAT(THF)AAGCAGGCGTTGAAG-3' ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) ddb2_human DNA damage-binding protein 2 Damage-specific DNA-binding protein 2 DDB p48 subunit UV-damaged DNA-binding protein 2 DDB2 protein protein human Homo sapiens Human MAPKKRPETQKTSEIVLRPRNKRSRSPLELEPEAKKLCAKGSGPSRRCDSDCLWVGLAGPQILPPCRSIVRTLHQHKLGRASWPSVQQGLQQSFLHTLDSYRILQKAAPFDRRATSLAWHPTHPSTVAVGSKGGDIMLWNFGIKDKPTFIKGIGAGGSITGLKFNPLNTNQFYASSMEGTTRLQDFKGNILRVFASSDTINIWFCSLDVSASSRMVVTGDNVGNVILLNMDGKELWNLRMHKKKVTHVALNPCCDWFLATASVDQTVKIWDLRQVRGKASFLYSLPHRHPVNAACFSPDGARLLTTDQKSEIRVYSASQWDCPLGLIPHPHRHFQHLTPIKAAWHPRYNLIVVGRYPDPNFKSCTPYELRTIDVFDGNSGKMMCQLYDPESSGISSLNEFNPMGDTLASAMGYHILIWSQEEARTRK DIP protein Q92466 original sequence version: 150 DIP protein Q92466 original sequence version: 145 DIP protein Q92466-1 original sequence version: 105 DIP protein Q92466-1 original sequence version: 120 DIP protein Q92466 original sequence version: 137 DIP protein Q92466 original sequence version: 142 E881F21242CA44D2 undamaged dna 5'-CTTCAACGCCTGCTTTATTCATTCAGGACTT-3' ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) CTTCAACGCCTGCTTTATTCATTCAGGACTT DNA synthesised for PMID: 19109893 97C96AEA03793AE9 dca11_human DDB1- and CUL4-associated factor 11 DCAF11 GL014 PRO2389 WDR23 WD repeat-containing protein 23 protein protein human Homo sapiens Human MGSRNSSSAGSGSGDPSEGLPRRGAGLRRSEEEEEEDEDVDLAQVLAYLLRRGQVRLVQGGGAANLQFIQALLDSEEENDRAWDGRLGDRYNPPVDATPDTRELEFNEIKTQVELATGQLGLRRAAQKHSFPRMLHQRERGLCHRGSFSLGEQSRVISHFLPNDLGFTDSYSQKAFCGIYSKDGQIFMSACQDQTIRLYDCRYGRFRKFKSIKARDVGWSVLDVAFTPDGNHFLYSSWSDYIHICNIYGEGDTHTALDLRPDERRFAVFSIAVSSDGREVLGGANDGCLYVFDREQNRRTLQIESHEDDVNAVAFADISSQILFSGGDDAICKVWDRRTMREDDPKPVGALAGHQDGITFIDSKGDARYLISNSKDQTIKLWDIRRFSSREGMEASRQAATQQNWDYRWQQVPKKAWRKLKLPGDSSLMTYRGHGVLHTLIRCRFSPIHSTGQQFIYSGCSTGKVVVYDLLSGHIVKKLTNHKACVRDVSWHPFEEKIVSSSWDGNLRLWQYRQAEYFQDDMPESEECASAPAPVPQSSTPFSSPQ 274A98A59059815D ddbi-ddb2-1 2 4 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. 6 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. direct interaction direct interaction The Overall Structure of the DDB1-DDB2 Complex Supp. Table 1 3.3A 24.2% working, 28.1% free ddbi-ddb2-2 2 4 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. 3 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. direct interaction direct interaction The Overall Structure of the DDB1-DDB2 Complex Supp. Table 1 2.3A 21.2% working, 25.5% free ddbi-ddb2-3 2 5 unspecified role unspecified role neutral component neutral component 4 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. 7 unspecified role unspecified role neutral component neutral component 3 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. physical association physical association The Overall Structure of the DDB1-DDB2 Complex Supp. Table 1 2.6A 22.0% working, 26.7% free ddb1-wdr23-1 1 4 unspecified role unspecified role prey prey region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. 8 unspecified role unspecified role bait bait n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region required to bind necessary binding region required to bind deletion analysis deletion analysis certain certain sequence position certain certain certain sequence position certain trini-high_5 Trichoplusia ni cell line from eggs high_5 Insect cell line from Trichoplusia ni egg cells Invitrogen supplies this cell line. Invitrogen supply this cell line. direct interaction direct interaction His-pulldown using His-tagged human WDR23 (WDR23L: G88-Q546; WDR23S: R155-Q546) as bait with GST-DDB1 as prey. Supp. Fig. 3F