IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ A novel nucleic acid-binding protein that interacts with human rad51 recombinase. A novel nucleic acid-binding protein that interacts with human rad51 recombinase. Nucleic Acids Res. (0305-1048) 1997 Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu Accepted 2007-JAN-10 by DAVET. 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. A novel nucleic acid-binding protein that interacts with human rad51 recombinase. Nucleic Acids Res. (0305-1048) 1997 Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu Accepted 2007-JAN-10 by DAVET. 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. A novel nucleic acid-binding protein that interacts with human rad51 recombinase. Nucleic Acids Res. (0305-1048) 1997 Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu Accepted 2007-JAN-10 by DAVET. 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 A novel nucleic acid-binding protein that interacts with human rad51 recombinase. A novel nucleic acid-binding protein that interacts with human rad51 recombinase. Nucleic Acids Res. (0305-1048) 1997 Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Kovalenko OV., Golub EI., Bray-Ward P., Ward DC., Radding CM. charles_radding@quickmail.yale.edu Accepted 2007-JAN-10 by DAVET. 23-JAN-2007: Contacted by JYOTI. cDNA library from HeLa S3 cells Nucleic Acids Res. (0305-1048) 1997 q96b01-1 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRLPEGTFSIPASAVPCTKMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALVTSVDSAPAAVKSESQSLPKKVSLSSDTTRKPLEIRSPSAESKKPKWVPPAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST No experimental confirmation available DIP protein Q96B01-1 original sequence version: 89 E582EE4BC459DD92 w16 oligonucleotide ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) TTGATAAGAGGTCATTTTTGCGGATGGCTTAGAGCTTAATTGCTGAATCTGGTGCTGTAGCTCAACATGTTTTAAATATGCAA 9ECC6A8B23C087D3 q96b01-2 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALVTSVDSAPAAVKSESQSLPKKVSLSSDTTRKPLEIRSPSAESKKPKWVPPAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST Ref.3 (AAH05973) sequence differs from that shown due to a frameshift in position 59 71BBA478F55C5D39 q96b01-3 RAD51-associated protein 1 RAD51AP1 PIR51 RAD51-interacting protein protein protein human Homo sapiens Human MVRPVRHKKPVNYSQFDHSDSDDDFVSATVPLNKKSRTAPKELKQDKPKPNLNNLRKEEIPVQEKTPKKRLPEGTFSIPASAVPCTKMALDDKLYQRDLEVALALSVKELPTVTTNVQNSQDKSIEKHGSSKIETMNKSPHISNCSVASDYLDLDKITVEDDVGGVQGKRKAASKAAAQQRKILLEGSDGDSANDTEPDFAPGEDSEDDSDFCESEDNDEDFSMRKSKVKEIKKKEVKVKSPVEKKEKKSKSKCNALAASGGSRSSSSPLVVVSVKSPNQSLRLGLSRLARVKPLHPNATST F667DBB6B8DF19E6 rad51_human DNA repair protein RAD51 homolog 1 RAD51 RAD51A RECA RAD51 homolog A protein protein human Homo sapiens Human MAMQMQLEANADTSVEEESFGPQPISRLEQCGINANDVKKLEEAGFHTVEAVAYAPKKELINIKGISEAKADKILAEAAKLVPMGFTTATEFHQRRSEIIQITTGSKELDKLLQGGIETGSITEMFGEFRTGKTQICHTLAVTCQLPIDRGGGEGKAMYIDTEGTFRPERLLAVAERYGLSGSDVLDNVAYARAFNTDHQTQLLYQASAMMVESRYALLIVDSATALYRTDYSGRGELSARQMHLARFLRMLLRLADEFGVAVVITNQVVAQVDGAAMFAADPKKPIGGNIIAHASTTRLYLRKGRGETRICKIYDSPCLPEAEAMFAINADGVGDAKD DIP protein Q06609 original sequence version: 154 DIP protein Q06609 original sequence version: 145 DIP protein Q06609 original sequence version: 122 DIP protein Q06609 original sequence version: 121 DIP protein Q06609 original sequence version: 125 DIP protein Q06609 original sequence version: 123 DIP protein Q06609 original sequence version: 144 DIP protein Q06609 original sequence version: 167 DIP protein Q06609 original sequence version: 169 26578E6206DEDEDA rad51-pir51 2 7 unspecified role unspecified role prey prey 9 unspecified role unspecified role bait bait physical association physical association 1 We used human Rad51 protein as a bait in a two-hybrid screen of a cDNA library prepared from human HeLa cells. rad51-pir51-1 2 9 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey physical association physical association 1 We used human Rad51 protein as a bait in a two-hybrid screen of a cDNA library prepared from human HeLa cells. The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. rad51-pir51-2 3 7 unspecified role unspecified role prey prey 9 unspecified role unspecified role bait bait physical association physical association table 1 The Rad51�Pir51 interaction was observed when either protein was fused to Gal4 DNA-binding or activation domain, rad51-pir51-3 3 9 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey physical association physical association table 1 The Rad51�Pir51 interaction was observed when either protein was fused to Gal4 DNA-binding or activation domain, The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. rad51-pir51-4 3 7 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey physical association physical association table 1 The Rad51�Pir51 interaction was observed when either protein was fused to Gal4 DNA-binding or activation domain, rad51-pir51-5 3 9 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait physical association physical association table 1 The Rad51�Pir51 interaction was observed when either protein was fused to Gal4 DNA-binding or activation domain, The deletion shown by the authors is longer encompassing AA 196-307 in the parent entry. rad51-rad51-6 3 9 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey physical association physical association table 1 pir51-rad51 4 9 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) physical association physical association 5 Interaction of Rad51 and Pir51 proteins in vitro. w16-pir5 1 8 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 6 A gel mobility shift assay was used for this purpose. First, two types of DNA substrates were utilized: (i) a single-stranded 83mer oligonucleotide, and (ii) linearized 6.4 kb double-stranded DNA of M13 phage. Indeed, we found that both 23.3 and 31.4 kDa forms of Pir51 protein bound both types of DNA in our assay (Figs 6 and 7B). w16-pir5-1 1 6 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 5 unspecified role unspecified role neutral component neutral component ecoli Escherichia coli (strain K12) direct interaction direct interaction 6 A gel mobility shift assay was used for this purpose. First, two types of DNA substrates were utilized: (i) a single-stranded 83mer oligonucleotide, and (ii) linearized 6.4 kb double-stranded DNA of M13 phage. Indeed, we found that both 23.3 and 31.4 kDa forms of Pir51 protein bound both types of DNA in our assay (Figs 6 and 7B).