IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. International journal of molecular sciences 2021 imex curation Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Only protein-protein interactions imex curation in vitro In vitro uv-vis ultraviolet-visible spectroscopy uv-vis predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) Thermal Difference Spectroscopy (TDS): This is obtained for a nucleic acid by recording the UV absorbance spectra of the unfolded and folded states at temperatures above and below its melting temperature (Tm). The difference between these two spectra is the TDS; it has a specific shape that is unique for each type of nucleic acid structure. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Accepted 2021-JUL-04 AT 15:02 BST AT 15:02 BST by KALPANAP International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. International journal of molecular sciences 2021 imex curation Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Only protein-protein interactions imex curation in vitro In vitro cd circular dichroism CD CD cd predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) Intramolecular G4s were folded by dissolving RNA oligonucleotides in buffer with different KCl or LiCl concentrations, heating for 5 min at 95 deg.C and slowly cooling to 20 deg.C, prior to recording spectra. For measuring interaction with CNBP the protein was added to G4/RNA folded in the presence of K+, then incubated with CNBP at 37 deg.C and spectra recorded at 20 deg. C. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Accepted 2021-JUL-04 AT 15:02 BST AT 15:02 BST by KALPANAP International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. International journal of molecular sciences 2021 imex curation Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Only protein-protein interactions imex curation in vitro In vitro fluorescence spectr classical fluorescence spectroscopy fluorescence spectr predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) ThT Fluorescence Assay:RNA oligonucleotides folded in buffer containing were mixed with ThT and loaded into 96-well black microplates. Fluorescence emission measurements were performed. A threshold of 10-fold increase was used for considering evidence of G4 formation. ThT Fluorescence Assay;Thioflavin T (ThT) becomes fluorescent in the presence of most, but not all G4-forming sequences, resulting in a large increase in ThT fluorescence emission. The presence of control duplexes and single strands had a more limited effect on emission. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Accepted 2021-JUL-04 AT 15:02 BST AT 15:02 BST by KALPANAP International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. International journal of molecular sciences 2021 imex curation Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Only protein-protein interactions imex curation in vitro In vitro nmr nuclear magnetic resonance NMR NMR nmr predetermined predetermined participant predetermined Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Accepted 2021-JUL-04 AT 15:02 BST AT 15:02 BST by KALPANAP International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation 1D 1H NMR spectra obtained for each RNA sequence folded in the presence of K+. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. CNBP Binds and Unfolds In Vitro G-Quadruplexes Formed in the SARS-CoV-2 Positive and Negative Genome Strands. International journal of molecular sciences 2021 imex curation Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight by sybr molecular weight estimation by sybr staining safe DNA gel stain safe DNA gel stain weight by sybr Bezzi G., Piga EJ., Binolfi A., Armas P., Bezzi G., Piga EJ., Binolfi A., Armas P. Virus - Publications including interactions involving viral proteins stoichiometry may, or may not be "4" for the G4 structures, so not entered. All SARS2 G4 oligos (except NRAS one for Tht Assay) have been entered with "Resulting sequence" as from Table 2 and NC_045512.2 Qualifier as "identity"; this differs from what I have done previously which is to enter the given sequence in the "box" for sequence and used "see-also" as the qualifier. (no ensembl entries for SARS2) RNA oligonucleotides used as probes were prefolded by thermal denaturation and slow renaturation in the presence of LiCl or KCl. SYBR Gold stain was used to detect nucleic acid bands. bezzi@ibr-conicet.gov.ar,piga@ibr-conicet.gov.ar,armas@ibr-conicet.gov.ar,binolfi@ibr-conicet.gov.ar Accepted 2021-JUL-04 AT 15:02 BST AT 15:02 BST by KALPANAP International journal of molecular sciences 2021 Only protein-protein interactions imex curation imex curation -23,877 (nsp3) NSP3 rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV promoter/pre-5'utr nras rna ribonucleic acid RNA rna human Homo sapiens Human UGUGGGAGGGGCGGGUCUGGG chr1:114716863-114716883 cnbp_human CCHC-type zinc finger nucleic acid binding protein Zinc finger protein 9 CNBP ZNF9 RNF163 Cellular nucleic acid-binding protein protein protein human Homo sapiens Human MSSNECFKCGRSGHWARECPTGGGRGRGMRSRGRGGFTSDRGFQFVSSSLPDICYRCGESGHLAKDCDLQEDACYNCGRGGHIAKDCKEPKREREQCCYNCGKPGHLARDCDHADEQKCYSCGEFGHIQKDCTKVKCYRCGETGHVAINCSKTSEVNCYRCGESGHLARECTIEATA 996F398285F52618 -13,963 (nsp12) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV +644 (nsp1) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV tht Thioflavin T small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) +28,903 (n) rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV +3467 (nsp3) NSP3 rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV +3467-+3467-1 4 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2B 1D 1H NMR showed defined signals around 11-12 ppm, confirming the presence of Hoogsteen bonds and G4 structures. 23,877 (nsp3)-1 2 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2A, Supp. figure 2E PQSs +3467 and -23,877 CD spectra have the typical pattern of peaks associated with parallel G4 structure. K+ +644 (nsp1)-+644 (nsp1)-1 2 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2A, Supp. figure 2A CD spectra also showed peaks associated with parallel G4s, but with a milder increase in the positive peak with increasing [K+]. These G4s are probably less stable or less prone to fold. K+ 23,877 (nsp3)-23,877 (nsp3)-1 2 9 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2A, Supp. figure 2D K+ CD spectra also showed peaks associated with parallel G4s, but with a milder increase in the positive peak with increasing [K+]. These G4s are probably less stable or less prone to fold. 13,963 (nsp12)-13,963 (nsp12)-1 4 9 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2B 1D 1H NMR also showed G4 signatures but signals were less intense than those for +3467 and −23,877, suggesting that there is a less amount of G4 probably due to lower stabilities and loose global conformation. +644 (nsp1)-+644 (nsp1)-2 4 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2B 1D 1H NMR also showed G4 signatures but signals were less intense than those for +3467 and −23,877, suggesting that there is a less amount of G4 probably due to lower stabilities and loose global conformation. 23,877 (nsp3)-23,877 (nsp3)-2 4 6 unspecified role unspecified role neutral component neutral component −23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role neutral component neutral component −23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2A 1D 1H NMR showed defined signals around 11–12 ppm, confirming the presence of Hoogsteen bonds and G4 structures. +3467 (nsp3)-+3467 (nsp3)-1 2 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2A, Supp. figure 2B PQSs +3467 and -23,877 CD spectra have the typical pattern of peaks associated with parallel G4 structure. K+ (CHEBI:29103) 234243-1 4 12 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 12 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 2B 1D 1H NMR did not show G4 signals in the 11-12 ppm region but showed a clear signal around 13.7 ppm, indicating that this sequence does not form Hoogsteen bonds (i.e., G4 structures) but instead contains Watson-Crick base pairs to some extent. cnbp-13,963 (nsp12)-1 5 8 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) 9 unspecified role unspecified role bait bait -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 3A Binding of CNBP to PQS -13,963 was less evident, as only mild shifts were observed at high CNBP concentrations. +644 (nsp1)-cnbp-1 5 8 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role bait bait 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP +3467 (nsp3)-cnbp-1 5 8 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) 13 unspecified role unspecified role bait bait 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP cnbp-23,877 (nsp3)-1 5 8 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role bait bait -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction 3A PQSs +644, +3467 and -23,877 clearly interacted with CNBP +3467 (nsp3)-+3467 (nsp3)-2 2 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 8 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 77 80 direct interaction direct interaction 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. +644 (nsp1)-+644 (nsp1)-3 2 8 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 84 86 direct interaction direct interaction 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. cnbp-13,963 (nsp12)-2 2 9 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role neutral component neutral component −13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 8 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 91 89 direct interaction direct interaction 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. cnbp-23,877 (nsp3)-2 2 8 inhibitor inhibitor neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 96 98 direct interaction direct interaction 3B CNBP caused a distortion and reduction of the characteristic G4 peaks of the spectra of the PQSs +644, +3467, -13,963 and -23,877. +3467 (nsp3)-+3467 (nsp3)-3 1 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S3 TDS spectra showed the typical G4 signature with two positive peaks around 243 and 273 nm and a negative peak at 295 nm. 23,877 (nsp3)-23,877 (nsp3)-3 1 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S3 TDS spectra showed the typical G4 signature with two positive peaks around 243 and 273 nm and a negative peak at 295 nm. 13,963 (nsp12)-13,963 (nsp12)-2 1 9 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S3 TDS spectra showed a less well defined spectrum for the −13,963 PQS as compared to +644, +3,467 and -23,877 PQS. +644 (nsp1)-+644 (nsp1)-4 1 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S3 TDS spectra showed the typical G4 signatures for the PQS +644. +28,903 (n)-+28,903 (n)-1 1 12 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 12 unspecified role unspecified role neutral component neutral component 28903-28917 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S3 A very low signal and poor defined spectrum was seen, which supports the absence of G4 structures and is probably compatible with self-complementary duplex structures. pre_5'utr nras-promoter/pre_5'utr nras-1 3 7 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S4 NRAS Human RNA oligo -Positive control:> X400 fluorescence Reference 90 (PMID: 17322877) is given for the NRAS Human RNA oligo as a positive control here. The sequence for the only oligo found in that publication has been used here, however the sequence does not lie in the 5' UTR as stated, but in a flanking region ~100 residues upstream of Exon 1 (Transcript: NRAS-201 ENST00000369535.5). there are several sequences relating to " NRAS 5′ UTR G-quadruplex" -but this was the only oligo I could find. There were lots of plasmids however. there are NO specific instructions in the manual for "RNA probes/oligos" - so I have added what I can. +3467 (nsp3)-+3467 (nsp3)-4 3 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component 3467-3484 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S4 ThT fluorescence was enhanced above 30-fold for +3467. +644 (nsp1)-+644 (nsp1)-5 3 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 10 unspecified role unspecified role neutral component neutral component 644-663 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S4 ThT fluorescence was increased barely above 10-fold. 13,963 (nsp12)-13,963 (nsp12)-3 3 13 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component -13,963/+15924-15941 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S4 ThT fluorescence was increased barely above 10-fold. 23,877 (nsp3)-23,877 (nsp3)-4 3 13 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component -23,877/+6011-6027 NSP3 sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Figure S4 ThT fluorescence was enhanced above 50-fold for −23,877.