IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. Virologica Sinica 2020 imex curation Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus zhangdy63@hotmail.com,zhouxi@wh.iov.cn 29-Mar-2021: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro triphosphatase ass nucleoside triphosphatase assay triphosphatase ass predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Accepted 2021-JAN-25 AT 16:18 GMT AT 16:18 GMT by KALPANAP Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. Virologica Sinica 2020 imex curation Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus zhangdy63@hotmail.com,zhouxi@wh.iov.cn 29-Mar-2021: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins I have not added any (Mg/Mn) metal ions as "interactors", as according to Yang -2017 reference, there is 1mM Mg2+ in the buffer for all the NTPase reactions. Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Accepted 2021-JAN-25 AT 16:18 GMT AT 16:18 GMT by KALPANAP Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. Virologica Sinica 2020 imex curation Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus zhangdy63@hotmail.com,zhouxi@wh.iov.cn 29-Mar-2021: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study tag fluorescence tag visualisation by fluorescence tag fluorescence Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Helicase Assay:(Duplex) Nucleic acid unwinding assay. Strand separation was monitored by SDS-PAGE; the HEX (Fluorescein) labeled RNA strand is released from dsRNA in the presence of Nsp13. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Accepted 2021-JAN-25 AT 16:18 GMT AT 16:18 GMT by KALPANAP Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. SARS-Coronavirus-2 Nsp13 Possesses NTPase and RNA Helicase Activities That Can Be Inhibited by Bismuth Salts. Virologica Sinica 2020 imex curation Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus zhangdy63@hotmail.com,zhouxi@wh.iov.cn 29-Mar-2021: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro gtpase assay gtpase assay GTPase gtp hydrolisis gtp hydrolisis GTPase predetermined predetermined participant predetermined Shu T., Huang M., Wu D., Ren Y., Zhang X., Han Y., Mu J., Wang R., Qiu Y., Zhang DY., Zhou X. Virus - Publications including interactions involving viral proteins Phosphate release was measured using a colorimetric method based on phosphate complexation with malachite green and molybdate. zhangdy63@hotmail.com,zhouxi@wh.iov.cn Accepted 2021-JAN-25 AT 16:18 GMT AT 16:18 GMT by KALPANAP Virologica Sinica 2020 Only protein-protein interactions imex curation imex curation bc BC small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) bpc BPC small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) ranitidine bismuth citrate Ranitidine bismuth citrate small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) rna_1_long RNA_1_long rna ribonucleic acid RNA rna synthetic construct synthetic construct CAUUAUCGGAUAGUGGAACCUAGCUUCGACUAUCGGAUAAUC atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) rna_4_short rna_4_short rna ribonucleic acid RNA rna in vitro In vitro GAUUAUCCGAUAGUCGAAGCUAGG rna_5_short RNA_5_short rna ribonucleic acid RNA rna in vitro In vitro GCUAGGUUCCACUAUCCGAUAAUG gtp guanosine triphosphate - GTP 5'-GTP GTP Guanosine 5'-triphosphate guanosine 5'-triphosphoric acid guanosine triphosphate GUANOSINE-5'-TRIPHOSPHATE H4gtp guanosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) InChI=1/C10H16N5O14P3/c11-10-13-7-4(8(18)14-10)12-2-15(7)9-6(17)5(16)3(27-9)1-26-31(22,23)29-32(24,25)28-30(19,20)21/h2-3,5-6,9,16-17H,1H2,(H,22,23)(H,24,25)(H2,19,20,21)(H3,11,13,14,18)/t3-,5-,6-,9-/m1/s1/f/h14,19-20,22,24H,11H2 InChI=1/C10H16N5O14P3/c11-10-13-7-4(8(18)14-10)12-2-15(7)9-6(17)5(16)3(27-9)1-26-31(22,23)29-32(24,25)28-30(19,20)21/h2-3,5-6,9,16-17H,1H2,(H,22,23)(H,24,25)(H2,19,20,21)(H3,11,13,14,18)/t3-,5-,6-,9-/m1/s1/f/h14,19-20,22,24H,11H2 rna_3_short RNA_3_short rna ribonucleic acid RNA rna in vitro In vitro CGAUAGUCGAAGCUAGGUUCCACUAUCC p0dtd1-pro_0000449630 Helicase nsp13 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AVGACVLCNSQTSLRCGACIRRPFLCCKCCYDHVISTSHKLVLSVNPYVCNAPGCDVTDVTQLYLGGMSYYCKSHKPPISFPLCANGQVFGLYKNTCVGSDNVTDFNAIATCDWTNAGDYILANTCTERLKLFAAETLKATEETFKLSYGIATVREVLSDRELHLSWEVGKPRPPLNRNYVFTGYRVTKNSKVQIGEYTFEKGDYGDAVVYRGTTTYKLNVGDYFVLTSHTVMPLSAPTLVPQEHYVRITGLYPTLNISDEFSSNVANYQKVGMQKYSTLQGPPGTGKSHFAIGLALYYPSARIVYTACSHAAVDALCEKALKYLPIDKCSRIIPARARVECFDKFKVNSTLEQYVFCTVNALPETTADIVVFDEISMATNYDLSVVNARLRAKHYVYIGDPAQLPAPRTLLTKGTLEPEYFNSVCRLMKTIGPDMFLGTCRRCPAEIVDTVSALVYDNKLKAHKDKSAQCFKMFYKGVITHDVSSAINRPQIGVVREFLTRNPAWRKAVFISPYNSQNAVASKILGLPTQTVDSSQGSEYDYVIFTQTTETAHSCNVNRFNVAITRAKVGILCIMSDRDLYDKLQFTSLEIPRRNVATLQ 5325 5925 utp UTP 5'-UTP H4utp Uridine 5'-triphosphate uridine 5'-triphosphoric acid Uridine triphosphate UTP uridine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) PGAVKCOVUIYSFO-XVFCMESISA-N PGAVKCOVUIYSFO-XVFCMESISA-N ctp CTP 5'-CTP CTP Cytidine 5'-triphosphate Cytidine triphosphate CYTIDINE-5'-TRIPHOSPHATE H4ctp cytidine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) PCDQPRRSZKQHHS-XVFCMESISA-N PCDQPRRSZKQHHS-XVFCMESISA-N rna_2_short RNA-2_short rna ribonucleic acid RNA rna in vitro In vitro AUAGUCGAAGCUAGGUUCCACUAU ctp-rep-1 1 16 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) triphosphatase react nucleoside triphosphatase reaction triphosphatase react 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. ctp-rep-2 1 15 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) triphosphatase react nucleoside triphosphatase reaction triphosphatase react 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. atp-rep-10 2 9 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) atpase reaction atpase reaction 1 A-D, 5A Optimal ATPase activity was shown in the presence of 2 mmol/L Mg2+. Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. Mg2+ gtp-rep-1 4 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 12 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) gtpase reaction gtpase reaction 1A Recombinant SARS-CoV-2 nsp13 could hydrolyze all four types of NTPs, with a preference for ATP and GTP. rep-rna_2_short-1 3 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 17 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 41 43 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 2B-D, (5B), 6 5B is in brackets as I assume Lane 3 (label ="I") is showing result without Bi salts -but this is not stated anywhere. rep-rna_1_long-1 3 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 13 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 52 50 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 3 ATP and GTP Efficiency of RNA helix-unwinding by nsp13 was limited in the presence of CTP and UTP. Mg2+ and to a lesser extent Mn2+. rep-rna_1_long-2 3 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 61 59 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 4, no 1 SARS-CoV-2 nsp13 efficiently unwound the RNA helix substrate with 5′-protrusion. rep-rna_1_long-3 3 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 11 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 70 68 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 4, no 2 SARS-CoV-2 nsp13 unwound the RNA helix substrate with 3′-protrusion less efficiently. The RNA helix substrate with blunt ends was not unwound at all. atp-rep-11 2 7 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 9 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) atpase reaction atpase reaction 5A, 6D atp-bpc-1 2 6 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 9 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) atpase reaction atpase reaction 5A, 6A atp-bpc-2 2 5 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 9 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) atpase reaction atpase reaction 5A rep-rna_1_long-4 3 6 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 17 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 98 96 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 5B, 6 A-C. bpc-rep-1 3 7 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 17 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 108 106 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 5B, 6 D-F. bc-rep-1 3 5 inhibitor inhibitor unspecified role unspecified role chemical synthesis Chemical synthesis (Chemical synthesis) 8 enzyme target enzyme target substrate substrate neutral component neutral component 5-prime fluorescein fluorescein label fluorescein certain certain sequence position certain certain certain sequence position certain whole molecule whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 17 enzyme target enzyme target substrate substrate neutral component neutral component whole molecule sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 14 enzyme enzyme neutral component neutral component purified purified n-terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 118 116 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 5B BC treatment also effectively inhibited the RNA helicase activity of nsp13, its inhibitory efficiency was in much less than BPC or RBC.