IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro spr surface plasmon resonance Optical biosensor BIAcore(r) BIAcore(r) Optical biosensor spr predetermined predetermined participant predetermined Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. This is a coupled ATPase assay; the rate of NADH absorbance decrease at 340 nm, is measured, which is proportional to the rate of steady-state ATP hydrolysis. The single stranded DNA used in this assay has been assumed to be "dT25" (25 thymine residues), as given under "Crystallization, data collection and structure determination", as this is the only single stranded DNA mentioned in the publication. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study weight identificat confirmation by molecular weight weight identificat Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. Helicase Assay:(Duplex) Nucleic acid unwinding assay. It has been assumed that Figure 1 results are derived using this method. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro h1-h2 ms mass spectrometry study of hydrogen/deuterium exchange h1-h2 ms ms participant Identification by mass spectrometry ms participant Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The single stranded DNA used in this assay has been assumed to be "dT25" (25 thymine residues), as given under "Crystallization, data collection and structure determination", as this is the only single stranded DNA mentioned in the publication. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro enzymatic study enzymatic study tag fluorescence tag visualisation by fluorescence tag fluorescence Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. Helicase Assay:(Duplex) Nucleic acid unwinding assay. The reaction of dsDNA unwinding to ssDNA was monitored by a reduction of quenching (by BHQ), -resulting in an increase in fluorescence on strand separation. Method using BHQ (Black Hole Quencher): Two fluorescently modified short oligonucleotides were annealed. One oligo was modified with cyanine 3 (Cy3), whereas the other is modified with a spectrally paired black hole quencher (BHQ) tag. Complete separation of the Cy3-modified strand is detected as an increase in total fluorescence. Black Hole Quencher® dyes are true "dark" quenchers with no fluorescent signal. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Delicate structural coordination of the Severe Acute Respiratory Syndrome coronavirus Nsp13 upon ATP hydrolysis. Nucleic acids research 2019 imex curation Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. The crystal is a monomer according to PDBe - so not entered. Helicase activity:dsDNA - sequences did not blast with >~50% to SARS. 7F sequence (EMSA) residues 13-44 blast to SARS Nsp7 but only first 31 residues of Nsp7, not 38 as stated. Results from Mol. Sieving Fig. S1 not entered as no M. Wts given, and no peak for ssDNA alone, so not very clear if an interaction occurs. raozh@mail.tsinghua.edu.cn 13-Nov-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight by staining molecular weight estimation by staining weight by staining Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z., Jia Z., Yan L., Ren Z., Wu L., Wang J., Guo J., Zheng L., Ming Z., Zhang L., Lou Z., Rao Z. Virus - Publications including interactions involving viral proteins The DNA sequence used is unclear H/D Exchange Experiments involving dsDNA have not been annotated as the sequence of DNA used is unclear. authors written to; date 15/10/20- regarding dsDNA sequence for H/D Exchange experiments - probably "a 3-fold molar excess of dsDNA screened out from SARS-CoVs genome for H/D exchange assay." - only they do not state which/what sequence this was - from "Nucleic acid unwinding assay" or EMSA or something else? If no reply I will not annotate these experiments. For Figure S4 there is a ssDNA - presumably the tX25 as used for ATPase assay? NO REPLY. raozh@mail.tsinghua.edu.cn Accepted 2020-NOV-04 AT 11:27 GMT AT 11:27 GMT by ORCHARD Nucleic acids research 2019 Only protein-protein interactions imex curation imex curation k9n7c7-pro_0000422449 RNA-directed RNA polymerase rep ORF1ab polyprotein 1a-1b protein protein cvemc Middle East respiratory syndrome-related coronavirus (isolate United Kingdom/H123990006/2012) (Betacoronavirus England 1) Betacoronavirus England 1 Human coronavirus EMC SKDSNFLKRVRGSIVNARIEPCSSGLSTDVVFRAFDICNYKAKVAGIGKYYKTNTCRFVELDDQGHHLDSYFVVKRHTMENYELEKHCYDLLRDCDAVAPHDFFIFDVDKVKTPHIVRQRLTEYTMMDLVYALRHFDQNSEVLKAILVKYGCCDVTYFENKLWFDFVENPSVIGVYHKLGERVRQAILNTVKFCDHMVKAGLVGVLTLDNQDLNGKWYDFGDFVITQPGSGVAIVDSYYSYLMPVLSMTDCLAAETHRDCDFNKPLIEWPLTEYDFTDYKVQLFEKYFKYWDQTYHANCVNCTDDRCVLHCANFNVLFAMTMPKTCFGPIVRKIFVDGVPFVVSCGYHYKELGLVMNMDVSLHRHRLSLKELMMYAADPAMHIASSNAFLDLRTSCFSVAALTTGLTFQTVRPGNFNQDFYDFVVSKGFFKEGSSVTLKHFFFAQDGNAAITDYNYYSYNLPTMCDIKQMLFCMEVVNKYFEIYDGGCLNASEVVVNNLDKSAGHPFNKFGKARVYYESMSYQEQDELFAMTKRNVIPTMTQMNLKYAISAKNRARTVAGVSILSTMTNRQYHQKMLKSMAATRGATCVIGTTKFYGGWDFMLKTLYKDVDNPHLMGWDYPKCDRAMPNMCRIFASLILARKHGTCCTTRDRFYRLANECAQVLSEYVLCGGGYYVKPGGTSSGDATTAYANSVFNILQATTANVSALMGANGNKIVDKEVKDMQFDLYVNVYRSTSPDPKFVDKYYAFLNKHFSMMILSDDGVVCYNSDYAAKGYIAGIQNFKETLYYQNNVFMSEAKCWVETDLKKGPHEFCSQHTLYIKDGDDGYFLPYPDPSRILSAGCFVDDIVKTDGTLMVERFVSLAIDAYPLTKHEDIEYQNVFWVYLQYIEKLYKDLTGHMLDSYSVMLCGDNSAKFWEEAFYRDLYSSPTTLQ 4378 5310 8951694330F081C4 ssdna_dt25 25 thymine single-stranded DNA ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct TTTTTTTTTTTTTTTTTTTTTTTTT 5'-3' long strand dna_2 ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct AATGTCTGACGTAAAGCCTCTAAAATGTCTG atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) p0c6x7-pro_0000037319 Helicase nsp13 ORF1ab polyprotein 1a-1b rep protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus AVGACVLCNSQTSLRCGACIRRPFLCCKCCYDHVISTSHKLVLSVNPYVCNAPGCDVTDVTQLYLGGMSYYCKSHKPPISFPLCANGQVFGLYKNTCVGSDNVTDFNAIATCDWTNAGDYILANTCTERLKLFAAETLKATEETFKLSYGIATVREVLSDRELHLSWEVGKPRPPLNRNYVFTGYRVTKNSKVQIGEYTFEKGDYGDAVVYRGTTTYKLNVGDYFVLTSHTVMPLSAPTLVPQEHYVRITGLYPTLNISDEFSSNVANYQKVGMQKYSTLQGPPGTGKSHFAIGLALYYPSARIVYTACSHAAVDALCEKALKYLPIDKCSRIIPARARVECFDKFKVNSTLEQYVFCTVNALPETTADIVVFDEISMATNYDLSVVNARLRAKHYVYIGDPAQLPAPRTLLTKGTLEPEYFNSVCRLMKTIGPDMFLGTCRRCPAEIVDTVSALVYDNKLKAHKDKSAQCFKMFYKGVITHDVSSAINRPQIGVVREFLTRNPAWRKAVFISPYNSQNAVASKILGLPTQTVDSSQGSEYDYVIFTQTTETAHSCNVNRFNVAITRAKIGILCIMSDRDLYDKLQFTSLEIPRRNVATLQ 5302 5902 3AFB2DC4596DB1F0 5'-3' long strand dna_1 ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct AATGTCTGACGTAAAGCCTCTAAAATGTCT p0c6x7-pro_0000037318 RNA-directed RNA polymerase nsp12 rep ORF1ab polyprotein 1a-1b protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus SADASTFLNRVCGVSAARLTPCGTGTSTDVVYRAFDIYNEKVAGFAKFLKTNCCRFQEKDEEGNLLDSYFVVKRHTMSNYQHEETIYNLVKDCPAVAVHDFFKFRVDGDMVPHISRQRLTKYTMADLVYALRHFDEGNCDTLKEILVTYNCCDDDYFNKKDWYDFVENPDILRVYANLGERVRQSLLKTVQFCDAMRDAGIVGVLTLDNQDLNGNWYDFGDFVQVAPGCGVPIVDSYYSLLMPILTLTRALAAESHMDADLAKPLIKWDLLKYDFTEERLCLFDRYFKYWDQTYHPNCINCLDDRCILHCANFNVLFSTVFPPTSFGPLVRKIFVDGVPFVVSTGYHFRELGVVHNQDVNLHSSRLSFKELLVYAADPAMHAASGNLLLDKRTTCFSVAALTNNVAFQTVKPGNFNKDFYDFAVSKGFFKEGSSVELKHFFFAQDGNAAISDYDYYRYNLPTMCDIRQLLFVVEVVDKYFDCYDGGCINANQVIVNNLDKSAGFPFNKWGKARLYYDSMSYEDQDALFAYTKRNVIPTITQMNLKYAISAKNRARTVAGVSICSTMTNRQFHQKLLKSIAATRGATVVIGTSKFYGGWHNMLKTVYSDVETPHLMGWDYPKCDRAMPNMLRIMASLVLARKHNTCCNLSHRFYRLANECAQVLSEMVMCGGSLYVKPGGTSSGDATTAYANSVFNICQAVTANVNALLSTDGNKIADKYVRNLQHRLYECLYRNRDVDHEFVDEFYAYLRKHFSMMILSDDAVVCYNSNYAAQGLVASIKNFKAVLYYQNNVFMSEAKCWTETDLTKGPHEFCSQHTMLVKQGDDYVYLPYPDPSRILGAGCFVDDIVKTDGTLMIERFVSLAIDAYPLTKHPNQEYADVFHLYLQYIRKLHDELTGHMLDMYSVMLTNDNTSRYWEPEFYEAMYTPHTVLQ 4370 5301 80FB0EF691E4A10E 5'-3' short strand dna ss dna single stranded deoxyribonucleic acid ss DNA ss dna synthetic construct synthetic construct CAGACATTTTAGAGG atp-rep-3 2 11 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.Lys288Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A Thu Oct 29 21:44:11 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Lys288Ala' P0C6X7-PRO_0000037319:p.Ser289Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain S A Thu Oct 29 22:55:50 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Ser289Ala' P0C6X7-PRO_0000037319:p.Asp374Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain D A Thu Oct 29 21:22:59 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Asp374Ala' P0C6X7-PRO_0000037319:p.Glu375Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain E A Thu Oct 29 22:26:39 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Glu375Ala' P0C6X7-PRO_0000037319:p.Gln404Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain Q A Thu Oct 29 21:21:44 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Gln404Ala' P0C6X7-PRO_0000037319:p.Arg567Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 22:07:12 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Arg567Ala' ecoli Escherichia coli (strain K12) 8 ancillary ancillary neutral component neutral component synthetic construct synthetic construct 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction 1C, 2 B/C, 7 C/D W.T. Vmax =0.5 uM/min Initial velocities for WT and mutants: 0.40 uM/s (WT-Nsp13), 0.19 uM/s (K288A), 0.19 uM/s (S289A), 0.17 uM/s (D374A), 0.18 uM/s (E375A), 0.17 uM/s (Q404A) and 0.17 uM/s (R567A). atp-rep-4 3 11 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 12 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 3' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 31 28 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 1D 5'_3' long strand dna_2-5'_3' short strand dna-1 5 11 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.Lys288Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A Thu Oct 29 21:25:45 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Lys288Ala' P0C6X7-PRO_0000037319:p.Ser289Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain S A Thu Oct 29 21:58:07 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Ser289Ala' P0C6X7-PRO_0000037319:p.Asp374Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain D A Thu Oct 29 23:00:52 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Asp374Ala' P0C6X7-PRO_0000037319:p.Glu375Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain E A Thu Oct 29 21:58:37 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Glu375Ala' P0C6X7-PRO_0000037319:p.Gln404Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain Q A Thu Oct 29 21:35:31 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Gln404Ala' P0C6X7-PRO_0000037319:p.Arg567Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 21:52:27 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Arg567Ala' P0C6X7-PRO_0000037319:p.Arg442Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 22:16:21 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.Arg442Ala' ecoli Escherichia coli (strain K12) 9 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 47 43 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 2 D-G, Supp. figure 3 The initial dsDNA concentration was 250 nM. 5'_3' long strand dna_2-5'_3' short strand dna-2 5 11 enzyme enzyme neutral component neutral component purified purified P0C6X7-PRO_0000037319:p.[Arg337Ala;Arg339Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain R A certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 21:41:27 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Arg337Ala;Arg339Ala]' P0C6X7-PRO_0000037319:p.[Lys345Ala;Lys347Ala] mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain K A Sun Dec 13 19:20:15 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Lys345Ala;Lys347Ala]' P0C6X7-PRO_0000037319:p.Arg507_Lys508delinsAlaAla mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain RK AA Thu Oct 29 22:41:05 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Arg507Ala;Lys508Ala]' P0C6X7-PRO_0000037319:p.[Lys524Ala;Gln531Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain Q A Thu Oct 29 21:28:20 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Lys524Ala;Gln531Ala]' P0C6X7-PRO_0000037319:p.[Ser539Ala;Tyr541Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain S A certain certain sequence position certain certain certain sequence position certain Y A Thu Oct 29 23:02:27 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Ser539Ala;Tyr541Ala]' P0C6X7-PRO_0000037319:p.[Asn179Ala;Arg212Ala] mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain R A certain certain sequence position certain certain certain sequence position certain N A Thu Oct 29 22:29:24 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Asn189Ala;Arg212Ala]' P0C6X7-PRO_0000037319:p.Asn102Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain N A P0C6X7-PRO_0000037319:p.Lys131Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain K A ecoli Escherichia coli (strain K12) 9 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 60 64 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 4 C/D, 6 E/F The initial dsDNA concentration was 400 nM. 5'_3' long strand dna_2-5'_3' short strand dna-3 5 11 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 13 stimulator stimulator neutral component neutral component purified purified 9 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 74 70 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 7 A/B SARS-Nsp12 and MERS-Nsp12 can enhance the unwinding activity of SARS-Nsp13. 5'_3' long strand dna_2-5'_3' short strand dna-4 5 11 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 7 stimulator stimulator neutral component neutral component purified purified 9 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain BHQ quencher dye labelled dye label dye labelled certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 10 ancillary ancillary neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 14 enzyme target enzyme target substrate substrate neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5' label cy3 label cy3 label certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 80 84 enzymatic reaction enzymatic reaction Biochemical reaction Biochemical reaction 7 A/B SARS-Nsp12 and MERS-Nsp12 can enhance the unwinding activity of SARS-Nsp13. atp-rep-5 2 13 stimulator stimulator neutral component neutral component purified purified 11 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 8 ancillary ancillary neutral component neutral component synthetic construct synthetic construct 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction 7 C/D Reaction velocities:- 0.24uM/s (SARS-Nsp13), 0.36uM/s (SARS-Nsp13 plus SARS-Nsp12). atp-rep-6 2 7 stimulator stimulator neutral component neutral component purified purified 11 enzyme enzyme neutral component neutral component purified purified ecoli Escherichia coli (strain K12) 8 ancillary ancillary neutral component neutral component synthetic construct synthetic construct 10 enzyme target enzyme target substrate substrate neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) atpase reaction atpase reaction 7 C/D Reaction velocities:- 0.24uM/s (SARS-Nsp13), 0.34uM/s (SARS-Nsp13 plus MERS-Nsp12). atp-rep-7 1 13 unspecified role unspecified role bait bait purified purified 11 unspecified role unspecified role prey prey purified purified ecoli Escherichia coli (strain K12) direct interaction direct interaction 7 E rep-ssdna_dt25-1 4 11 unspecified role unspecified role neutral component neutral component purified purified binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 8 unspecified role unspecified role neutral component neutral component synthetic construct synthetic construct direct interaction direct interaction Supp. figure 4 rep-rep-141 4 11 unspecified role unspecified role neutral component neutral component purified purified binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain binding region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 13 unspecified role unspecified role neutral component neutral component direct interaction direct interaction Supp. figure 7 5'_3' long strand dna_2-5'_3' short strand dna-5 6 11 unspecified role unspecified role neutral component neutral component P0C6X7-PRO_0000037319:p.[Asn179Ala;Arg212Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain N A certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 22:34:18 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Asn189Ala;Arg212Ala]' P0C6X7-PRO_0000037319:p.[Arg337Ala;Arg339Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain R A certain certain sequence position certain certain certain sequence position certain R A Thu Oct 29 21:41:02 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Arg337Ala;Arg339Ala]' P0C6X7-PRO_0000037319:p.[Lys345Ala;Lys347Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain K A Sun Dec 13 19:37:27 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Lys345Ala;Lys347Ala]' P0C6X7-PRO_0000037319:p.Arg507_Lys508delinsAlaAla mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain RK AA Thu Oct 29 21:35:13 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Arg507Ala;Lys508Ala]' P0C6X7-PRO_0000037319:p.[Lys524Ala;Gln531Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain Q A Thu Oct 29 22:35:00 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Lys524Ala;Gln531Ala]' P0C6X7-PRO_0000037319:p.[Ser539Ala;Tyr541Ala] mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain S A certain certain sequence position certain certain certain sequence position certain Y A Thu Oct 29 22:55:45 GMT 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p0c6x7-pro_0000037319:p.[Ser539Ala;Tyr541Ala]' ecoli Escherichia coli (strain K12) 9 unspecified role unspecified role neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 14 unspecified role unspecified role neutral component neutral component binding region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain synthetic construct synthetic construct 124 122 physical association physical association 4B