IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions. DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions. Nucleic acids research 2015 imex curation Chen Y., Chen C., Zhang Z., Liu CC., Johnson ME., Espinoza CA., Edsall LE., Ren B., Zhou XJ., Grant SF., Wells AD., Chen L. IBD - Inflammatory bowel disease I had hoped to annotate the 4C data - but too much of it. (and the Supp table/figures have no labels) linchen@usc.edu,adwells@mail.med.upenn.edu 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Chen Y., Chen C., Zhang Z., Liu CC., Johnson ME., Espinoza CA., Edsall LE., Ren B., Zhou XJ., Grant SF., Wells AD., Chen L. IBD - Inflammatory bowel disease I had hoped to annotate the 4C data - but too much of it. (and the Supp table/figures have no labels) CD4+CD25− T cells transduced with either empty retroviral vector or vector encoding FOXP3. Cells were re-stimulated with anti-CD3/28. Results for both 4930583H14Rik and Il20rb genomic regions have not been entered as the primers do not align to any gene on blatting, nor do the Ensembl Blast results -neither do the genomic coordinates correspond to those quoted here (assembly used not known). However Uniprot (and elsewhere) state that the 4930583H14Rik protein corresponds to a gene "Mgarp" or "Hmmr". linchen@usc.edu,adwells@mail.med.upenn.edu Accepted 2015-OCT-07 AT 15:27 BST AT 15:27 BST by ORCHARD Nucleic acids research 2015 Only protein-protein interactions imex curation imex curation DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions. DNA binding by FOXP3 domain-swapped dimer suggests mechanisms of long-range chromosomal interactions. Nucleic acids research 2015 imex curation Chen Y., Chen C., Zhang Z., Liu CC., Johnson ME., Espinoza CA., Edsall LE., Ren B., Zhou XJ., Grant SF., Wells AD., Chen L. IBD - Inflammatory bowel disease I had hoped to annotate the 4C data - but too much of it. (and the Supp table/figures have no labels) linchen@usc.edu,adwells@mail.med.upenn.edu 21-10-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Chen Y., Chen C., Zhang Z., Liu CC., Johnson ME., Espinoza CA., Edsall LE., Ren B., Zhou XJ., Grant SF., Wells AD., Chen L. IBD - Inflammatory bowel disease I had hoped to annotate the 4C data - but too much of it. (and the Supp table/figures have no labels) linchen@usc.edu,adwells@mail.med.upenn.edu Accepted 2015-OCT-07 AT 15:27 BST AT 15:27 BST by ORCHARD Nucleic acids research 2015 Only protein-protein interactions imex curation imex curation nfkb1_mouse_gene Nuclear factor NF-kappa-B p105 subunit Nfkb1 gene gene mouse Mus musculus Mouse foxp3_mouse Forkhead box protein P3 Foxp3 Scurfin protein protein mouse Mus musculus Mouse MPNPRPAKPMAPSLALGPSPGVLPSWKTAPKGSELLGTRGSGGPFQGRDLRSGAHTSSSLNPLPPSQLQLPTVPLVMVAPSGARLGPSPHLQALLQDRPHFMHQLSTVDAHAQTPVLQVRPLDNPAMISLPPPSAATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPRSGTPRKDSNLLAAPQGSYPLLANGVCKWPGCEKVFEEPEEFLKHCQADHLLDEKGKAQCLLQREVVQSLEQQLELEKEKLGAMQAHLAGKMALAKAPSVASMDKSSCCIVATSTQGSVLPAWSAPREAPDGGLFAVRRHLWGSHGNSSFPEFFHNMDYFKYHNMRPPFTYATLIRWAILEAPERQRTLNEIYHWFTRMFAYFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDEFEFRKKRSQRPNKCSNPCP DIP protein Q99JB6 original sequence version: 120 DIP protein Q99JB6 original sequence version: 110 DIP protein Q99JB6 original sequence version: 114 DIP protein Q99JB6 original sequence version: 102 DIP protein Q99JB6 original sequence version: 100 28D5B8E67891840C npr1_mouse_gene Npr1 gene gene mouse Mus musculus Mouse i17ra_mouse_gene Interleukin-17 receptor A gene gene mouse Mus musculus Mouse foxp3_human Forkhead box protein P3 Scurfin FOXP3 IPEX JM2 protein protein human Homo sapiens Human MPNPRPGKPSAPSLALGPSPGASPSWRAAPKASDLLGARGPGGTFQGRDLRGGAHASSSSLNPMPPSQLQLPTLPLVMVAPSGARLGPLPHLQALLQDRPHFMHQLSTVDAHARTPVLQVHPLESPAMISLTPPTTATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPNPSAPRKDSTLSAVPQSSYPLLANGVCKWPGCEKVFEEPEDFLKHCQADHLLDEKGRAQCLLQREMVQSLEQQLVLEKEKLSAMQAHLAGKMALTKASSVASSDKGSCCIVAAGSQGPVVPAWSGPREAPDSLFAVRRHLWGSHGNSTFPEFLHNMDYFKFHNMRPPFTYATLIRWAILEAPEKQRTLNEIYHWFTRMFAFFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDELEFRKKRSQRPSRCSNPTPGP DIP protein Q9BZS1 original sequence version: 139 DIP protein Q9BZS1 original sequence version: 131 91737C3CEA665A15 igsf3_mouse_gene Immunoglobulin superfamily member 3 Igsf3 Kiaa0466 gene gene mouse Mus musculus Mouse mouse_arre2_site_il2_promoter_2 dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse TTAGGAAAATTTGTTTCATAG igsf2_mouse_gene Immunoglobulin superfamily member 2 Cd101 Igsf2 gene gene mouse Mus musculus Mouse mouse_arre2_site_il2_promoter_1 dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse AACTATGAAACAAATTTTCCT il2_mouse_gene Interleukin-2 Il2 Il-2 gene gene mouse Mus musculus Mouse ptn22_mouse_gene Tyrosine-protein phosphatase non-receptor type 22 Ptpn22 Ptpn8 gene gene mouse Mus musculus Mouse il21_mouse_gene Interleukin-21 gene gene gene mouse Mus musculus Mouse foxp3-mouse_arre2_site_il2_promoter_1-1 2 7 unspecified role unspecified role neutral component neutral component forkhead_domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 9 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Table 1 3.4A Rwork 0.19 RFree 0.252 I have taken the length of Foxp3 from the M+M section - PBBe and the main body of the paper give slightly different lengths of construct used. foxp3-ptpn22-1 1 13 unspecified role unspecified role prey prey intronic_and_exonic_regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2B, Supp 6A Q99JB6 decreases expression at RNA level of ENSMUSG00000027843 foxp3-il21_mouse_gene-1 1 14 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2Bi, Supp 6A Q99JB6 decreases expression at RNA level of ENSMUSG00000027718 foxp3-il2-7 1 12 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2Bii, Supp 6A Q99JB6 decreases expression at RNA level of ENSMUSG00000027720 foxp3-nfkb1-1 1 3 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2Biii, Supp 6A foxp3-npr1-1 1 5 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2Biv, Supp 6A Q99JB6 decreases expression at RNA level of ENSMUSG00000027931 foxp3-i17ra_mouse_gene-1 1 6 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association 2Bv, Supp 6A Q99JB6 increases expression at RNA level of ENSMUSG000000028 foxp3-igsf3-1 1 8 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association Supp 6A foxp3-cd101-1 1 10 unspecified role unspecified role prey prey regions sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range association association Supp 6Ai