IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Hepatocyte nuclear factor 4α (HNF4α) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Hepatocyte nuclear factor 4α (HNF4α) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. J. Cell. Biochem. (0730-2312) 2014 imex curation Zolfaghari R., Ross A.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease acr6@psu.edu 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Zolfaghari R., Ross A.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis EMSA probe sequences taken from the Zheng-2010 reference, figure 6. acr6@psu.edu Accepted 2015-JAN-27 by MGT J. Cell. Biochem. (0730-2312) 2014 Only protein-protein interactions imex curation Hepatocyte nuclear factor 4α (HNF4α) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. Hepatocyte nuclear factor 4α (HNF4α) in coordination with retinoic acid receptors increases all-trans-retinoic acid-dependent CYP26A1 gene expression in HepG2 human hepatocytes. J. Cell. Biochem. (0730-2312) 2014 imex curation Zolfaghari R., Ross A.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease acr6@psu.edu 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Zolfaghari R., Ross A.C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis CYP26A1 promoter DNA also co-precipitated from HepG2 cells with anti-RAR antibody; however, due to the broad specificity of the antibody, a specific RAR family member could not be identified as a participant in this interaction, hence it is not captured here. acr6@psu.edu Accepted 2015-JAN-27 by MGT J. Cell. Biochem. (0730-2312) 2014 Only protein-protein interactions imex curation cp26a_human_gene Cytochrome P450 26A1 (CYP26A1) human gene gene gene human Homo sapiens Human rpb1_human DNA-directed RNA polymerase II subunit RPB1 POLR2A DNA-directed RNA polymerase II subunit A DNA-directed RNA polymerase III largest subunit POLR2 RNA-directed RNA polymerase II subunit RPB1 protein protein human Homo sapiens Human MHGGGPPSGDSACPLRTIKRVQFGVLSPDELKRMSVTEGGIKYPETTEGGRPKLGGLMDPRQGVIERTGRCQTCAGNMTECPGHFGHIELAKPVFHVGFLVKTMKVLRCVCFFCSKLLVDSNNPKIKDILAKSKGQPKKRLTHVYDLCKGKNICEGGEEMDNKFGVEQPEGDEDLTKEKGHGGCGRYQPRIRRSGLELYAEWKHVNEDSQEKKILLSPERVHEIFKRISDEECFVLGMEPRYARPEWMIVTVLPVPPLSVRPAVVMQGSARNQDDLTHKLADIVKINNQLRRNEQNGAAAHVIAEDVKLLQFHVATMVDNELPGLPRAMQKSGRPLKSLKQRLKGKEGRVRGNLMGKRVDFSARTVITPDPNLSIDQVGVPRSIAANMTFAEIVTPFNIDRLQELVRRGNSQYPGAKYIIRDNGDRIDLRFHPKPSDLHLQTGYKVERHMCDGDIVIFNRQPTLHKMSMMGHRVRILPWSTFRLNLSVTTPYNADFDGDEMNLHLPQSLETRAEIQELAMVPRMIVTPQSNRPVMGIVQDTLTAVRKFTKRDVFLERGEVMNLLMFLSTWDGKVPQPAILKPRPLWTGKQIFSLIIPGHINCIRTHSTHPDDEDSGPYKHISPGDTKVVVENGELIMGILCKKSLGTSAGSLVHISYLEMGHDITRLFYSNIQTVINNWLLIEGHTIGIGDSIADSKTYQDIQNTIKKAKQDVIEVIEKAHNNELEPTPGNTLRQTFENQVNRILNDARDKTGSSAQKSLSEYNNFKSMVVSGAKGSKINISQVIAVVGQQNVEGKRIPFGFKHRTLPHFIKDDYGPESRGFVENSYLAGLTPTEFFFHAMGGREGLIDTAVKTAETGYIQRRLIKSMESVMVKYDATVRNSINQVVQLRYGEDGLAGESVEFQNLATLKPSNKAFEKKFRFDYTNERALRRTLQEDLVKDVLSNAHIQNELEREFERMREDREVLRVIFPTGDSKVVLPCNLLRMIWNAQKIFHINPRLPSDLHPIKVVEGVKELSKKLVIVNGDDPLSRQAQENATLLFNIHLRSTLCSRRMAEEFRLSGEAFDWLLGEIESKFNQAIAHPGEMVGALAAQSLGEPATQMTLNTFHYAGVSAKNVTLGVPRLKELINISKKPKTPSLTVFLLGQSARDAERAKDILCRLEHTTLRKVTANTAIYYDPNPQSTVVAEDQEWVNVYYEMPDFDVARISPWLLRVELDRKHMTDRKLTMEQIAEKINAGFGDDLNCIFNDDNAEKLVLRIRIMNSDENKMQEEEEVVDKMDDDVFLRCIESNMLTDMTLQGIEQISKVYMHLPQTDNKKKIIITEDGEFKALQEWILETDGVSLMRVLSEKDVDPVRTTSNDIVEIFTVLGIEAVRKALERELYHVISFDGSYVNYRHLALLCDTMTCRGHLMAITRHGVNRQDTGPLMKCSFEETVDVLMEAAAHGESDPMKGVSENIMLGQLAPAGTGCFDLLLDAEKCKYGMEIPTNIPGLGAAGPTGMFFGSAPSPMGGISPAMTPWNQGATPAYGAWSPSVGSGMTPGAAGFSPSAASDASGFSPGYSPAWSPTPGSPGSPGPSSPYIPSPGGAMSPSYSPTSPAYEPRSPGGYTPQSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPNYTPTSPSYSPTSPSYSPTSPNYTPTSPNYSPTSPSYSPTSPSYSPTSPSYSPSSPRYTPQSPTYTPSSPSYSPSSPSYSPASPKYTPTSPSYSPSSPEYTPTSPKYSPTSPKYSPTSPKYSPTSPTYSPTTPKYSPTSPTYSPTSPVYTPTSPKYSPTSPTYSPTSPKYSPTSPTYSPTSPKGSTYSPTSPGYSPTSPTYSLTSPAISPDDSDEEN DIP protein P24928 original sequence version: 108 DIP protein P24928 original sequence version: 147 DIP protein P24928 original sequence version: 158 DIP protein P24928 original sequence version: 157 DIP protein P24928 original sequence version: 179 DIP protein P24928 original sequence version: 181 DIP protein P24928 original sequence version: 161 DIP protein P24928 original sequence version: 175 DIP protein P24928-1 original sequence version: 175 DIP protein P24928 original sequence version: 68 DIP protein P24928 original sequence version: 116 28D6FD25693A6472 cp26a_human_rare2_dna-probe Human CP26A gene promoter retinoic acid response element 2 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTGCAGGGGTCACAGGCGGGTCAGGCCCG cp26a_human_rare1_dna-probe Human CP26A gene promoter retinoic acid response element 1 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TAAAGATGAACTTTGGGTGAACTAATTGT hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF hnf4a-cp26a-1 2 3 unspecified role unspecified role prey prey promoter region proximal binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region distal binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association Fig. 5c, 5d all-trans-retinoic acid (CHEBI:15367) CHEBI:15367 increases binding of P41235 to ENSG00000095596 CHEBI:15367 indirectly increases expression at RNA level of ENSG00000095596 CHEBI:15367 increases expression at RNA level of P41235. CHEBI:15367 increases expression at protein level of P41235. P41235 and CHEBI:15367 increases expression at RNA level of ENSG00000095596. HNF4a did not have any significant effect on the promoter activity of the CYP26A1 gene in HepG2 cells in the absence of RA. polr2a-cp26a-1 2 3 unspecified role unspecified role prey prey promoter region distal binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region proximal binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait association association Fig. 5b, 5c, 5d all-trans-retinoic acid (CHEBI:15367) CHEBI:15367 increases binding of P24928 to ENSG00000095596 cp26a-hnf4a-2 1 6 unspecified role unspecified role bait bait 5-prime 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association Fig. 5a cp26a-hnf4a-1 1 5 unspecified role unspecified role bait bait 5-prime 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 7 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association Fig. 5a