IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Intestinal DMBT1 expression is modulated by Crohn's disease-associated IL23R variants and by a DMBT1 variant which influences binding of the transcription factors CREB1 and ATF-2. Intestinal DMBT1 expression is modulated by Crohn's disease-associated IL23R variants and by a DMBT1 variant which influences binding of the transcription factors CREB1 and ATF-2. PloS one 2012 imex curation Diegelmann J., Czamara D., Le Bras E., Zimmermann E., Olszak T., Bedynek A., Göke B., Franke A., Glas J., Brand S. Crohn's disease - Interactions of proteins identified as having a link to Crohn's disease IBD - Inflammatory bowel disease I cannot see there are any Causality statements I could add stephan.brand@med.uni-muenchen.de 17-Sep-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Diegelmann J., Czamara D., Le Bras E., Zimmermann E., Olszak T., Bedynek A., Göke B., Franke A., Glas J., Brand S. Crohn's disease - Interactions of proteins identified as having a link to Crohn's disease I cannot see there are any Causality statements I could add stephan.brand@med.uni-muenchen.de Accepted 2015-AUG-18 by PPORRAS PloS one 2012 Only protein-protein interactions imex curation imex curation creb1_human Cyclic AMP-responsive element-binding protein 1 CREB1 protein protein human Homo sapiens Human MTMESGAENQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD DIP protein P16220 original sequence version: 169 DIP protein P16220 original sequence version: 158 F5BA8200EE5184B7 dmbt1_probe_ rs2981804_allele_a probe from SNP rs2981804 risk allele A ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CCTGCTAACGTAACCAAATTGCTA creb1_probe ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human AGAGATTGCCTGACGTCAGAGAGCTAG atf2_human Cyclic AMP-dependent transcription factor ATF-2 ATF2 CREB2 CREBP1 Activating transcription factor 2 cAMP response element-binding protein CRE-BP1 HB16 Cyclic AMP-responsive element-binding protein 2 protein protein human Homo sapiens Human MKFKLHVNSARQYKDLWNMSDDKPFLCTAPGCGQRFTNEDHLAVHKHKHEMTLKFGPARNDSVIVADQTPTPTRFLKNCEEVGLFNELASPFENEFKKASEDDIKKMPLDLSPLATPIIRSKIEEPSVVETTHQDSPLPHPESTTSDEKEVPLAQTAQPTSAIVRPASLQVPNVLLTSSDSSVIIQQAVPSPTSSTVITQAPSSNRPIVPVPGPFPLLLHLPNGQTMPVAIPASITSSNVHVPAAVPLVRPVTMVPSVPGIPGPSSPQPVQSEAKMRLKAALTQQHPPVTNGDTVKGHGSGLVRTQSEESRPQSLQQPATSTTETPASPAHTTPQTQSTSGRRRRAANEDPDEKRRKFLERNRAAASRCRQKRKVWVQSLEKKAEDLSSLNGQLQSEVTLLRNEVAQLKQLLLAHKDCPVTAMQKKSGYHTADKDDSSEDISVPSSPHTEAIQHSSVSTSNGVSSTSKAEAVATSVLTQMADQSTEPALSQIVMAPSSQSQPSGS 0190EEFAEC8891A7 dmbt1_probe_ rs2981804_allele_a-atf2-1 1 3 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association 4B dmbt1_probe_ rs2981804_allele_a-creb1-1 1 3 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 2 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association 4Bi dmbt1_probe_ rs2981804_allele_a-creb1-2 1 4 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 2 unspecified role unspecified role prey prey human-dld1 Human colorectal adenocarcinoma dld1 Human colon adenocarcinoma physical association physical association 4C