IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. Liver Int. (1478-3223) 2013 imex curation Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease emezey@jhmi.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro nucl ac uv crosslink nucleic acid uv cross-linking assay nucl ac uv crosslink western blot western blot Immuno blot Immuno blot Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease Cross-linking was performed with nuclear extracts from LX-2 cells exposed to 1,25-(OH)2D3 (the active form of vitamin D3) (CHEBI:17823) (10 ng/ml) for 24 hours. emezey@jhmi.edu Accepted 2014-NOV-10 by ORCHARD Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. Liver Int. (1478-3223) 2013 imex curation Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease emezey@jhmi.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease The ChIP assay was performed with LX-2 cells exposed to 1,25-(OH)2D3 (the active form of vitamin D3) (CHEBI:17823) (10 nanomolar) for 24 hours. emezey@jhmi.edu Accepted 2014-NOV-10 by ORCHARD Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. 1,25-dihydroxyvitamin D3 and its nuclear receptor repress human α1 (I) collagen expression and type I collagen formation. Liver Int. (1478-3223) 2013 imex curation Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease emezey@jhmi.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Potter J.J., Liu X., Koteish A., Mezey E. IBD - Inflammatory bowel disease emezey@jhmi.edu Accepted 2014-NOV-10 by ORCHARD Liver Int. (1478-3223) 2013 Only protein-protein interactions imex curation co1a1_human_gene Collagen alpha-1(I) chain (CO1A1) human gene gene gene human Homo sapiens Human vdr_human Vitamin D3 receptor 1,25-dihydroxyvitamin D3 receptor Nuclear receptor subfamily 1 group I member 1 VDR NR1I1 protein protein human Homo sapiens Human MEAMAASTSLPDPGDFDRNVPRICGVCGDRATGFHFNAMTCEGCKGFFRRSMKRKALFTCPFNGDCRITKDNRRHCQACRLKRCVDIGMMKEFILTDEEVQRKREMILKRKEEEALKDSLRPKLSEEQQRIIAILLDAHHKTYDPTYSDFCQFRPPVRVNDGGGSHPSRPNSRHTPSFSGDSSSSCSDHCITSSDMMDSSSFSNLDLSEEDSDDPSVTLELSQLSMLPHLADLVSYSIQKVIGFAKMIPGFRDLTSEDQIVLLKSSAIEVIMLRSNESFTMDDMSWTCGNQDYKYRVSDVTKAGHSLELIEPLIKFQVGLKKLNLHEEEHVLLMAICIVSPDRPGVQDAALIEAIQDRLSNTLQTYIRCRHPPPGSHLLYAKMIQKLADLRSLNEEHSKQYRCLSFQPECSMKLTPLVLEVFGNEIS DIP protein P11473 original sequence version: 179 DIP protein P11473 original sequence version: 146 F95F300D042C4CB7 rxra_human Retinoic acid receptor RXR-alpha RXRA NR2B1 Retinoid X receptor alpha Nuclear receptor subfamily 2 group B member 1 protein protein human Homo sapiens Human MDTKHFLPLDFSTQVNSSLTSPTGRGSMAAPSLHPSLGPGIGSPGQLHSPISTLSSPINGMGPPFSVISSPMGPHSMSVPTTPTLGFSTGSPQLSSPMNPVSSSEDIKPPLGLNGVLKVPAHPSGNMASFTKHICAICGDRSSGKHYGVYSCEGCKGFFKRTVRKDLTYTCRDNKDCLIDKRQRNRCQYCRYQKCLAMGMKREAVQEERQRGKDRNENEVESTSSANEDMPVERILEAELAVEPKTETYVEANMGLNPSSPNDPVTNICQAADKQLFTLVEWAKRIPHFSELPLDDQVILLRAGWNELLIASFSHRSIAVKDGILLATGLHVHRNSAHSAGVGAIFDRVLTELVSKMRDMQMDKTELGCLRAIVLFNPDSKGLSNPAEVEALREKVYASLEAYCKHKYPEQPGRFAKLLLRLPALRSIGLKCLEHLFFFKLIGDTPIDTFLMEMLEAPHQMT DIP protein P19793 original sequence version: 177 DIP protein P19793 original sequence version: 107 DIP protein P19793 original sequence version: 153 DIP protein P19793 original sequence version: 131 DIP protein P19793 original sequence version: 136 DIP protein P19793 original sequence version: 169 DIP protein P19793 original sequence version: 161 DIP protein P19793 original sequence version: 139 7F952B580AD84C42 sp1_human Transcription factor Sp1 SP1 TSFP1 protein protein human Homo sapiens Human MSDQDHSMDEMTAVVKIEKGVGGNNGGNGNGGGAFSQARSSSTGSSSSTGGGGQESQPSPLALLAATCSRIESPNENSNNSQGPSQSGGTGELDLTATQLSQGANGWQIISSSSGATPTSKEQSGSSTNGSNGSESSKNRTVSGGQYVVAAAPNLQNQQVLTGLPGVMPNIQYQVIPQFQTVDGQQLQFAATGAQVQQDGSGQIQIIPGANQQIITNRGSGGNIIAAMPNLLQQAVPLQGLANNVLSGQTQYVTNVPVALNGNITLLPVNSVSAATLTPSSQAVTISSSGSQESGSQPVTSGTTISSASLVSSQASSSSFFTNANSYSTTTTTSNMGIMNFTTSGSSGTNSQGQTPQRVSGLQGSDALNIQQNQTSGGSLQAGQQKEGEQNQQTQQQQILIQPQLVQGGQALQALQAAPLSGQTFTTQAISQETLQNLQLQAVPNSGPIIIRTPTVGPNGQVSWQTLQLQNLQVQNPQAQTITLAPMQGVSLGQTSSSNTTLTPIASAASIPAGTVTVNAAQLSSMPGLQTINLSALGTSGIQVHPIQGLPLAIANAPGDHGAQLGLHGAGGDGIHDDTAGGEEGENSPDAQPQAGRRTRREACTCPYCKDSEGRGSGDPGKKKQHICHIQGCGKVYGKTSHLRAHLRWHTGERPFMCTWSYCGKRFTRSDELQRHKRTHTGEKKFACPECPKRFMRSDHLSKHIKTHQNKKGGPGVALSVGTLPLDSGAGSEGSGTATPSALITTNMVAMEAICPEGIARLANSGINVMQVADLQSINISGNGF DIP protein P08047 original sequence version: 185 DIP protein P08047 original sequence version: 187 DIP protein P08047 original sequence version: 181 DIP protein P08047 original sequence version: 162 DIP protein P08047 original sequence version: 161 43893DBF6518B9EA spb_human_nkx2.1-site_dna-probe Human SPB gene promoter transcription factor NKX2.1 binding motif DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CACCTGGAGGGCTCTTCAGAGC co1a1_human_vdr-site_dna-probe Human CO1A1 gene promoter vitamin D receptor binding motif DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCACACCTTGGAGGTTTCAACT vdr-co1a1-1 2 4 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role bait bait association association Fig. 3e P11473 decreases expression at RNA level of ENSG00000108821 P11473 and P08047 decreases expression at RNA level of ENSG00000108821 rxra-co1a1-1 2 4 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait association association Fig. 3e sp1-co1a1-1 2 4 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association Fig. 3e P08047 decreases expression at RNA level of ENSG00000108821 co1a1-vdr-2 3 5 unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 9 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined tcacaccttgg-to-tcacacctttt mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3a, 3b co1a1-vdr-3 1 5 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 9 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3c co1a1-sp1-2 1 9 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 7 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association Fig. 3c co1a1-rxra-2 1 9 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association Fig. 3c co1a1-rxra-1 1 8 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association Fig. 3d co1a1-vdr-1 1 8 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 5 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 physical association physical association Fig. 3d co1a1-sp1-1 1 7 western blot western blot Immuno blot Immuno blot western blot western blot Immuno blot Immuno blot unspecified role unspecified role prey prey human-lx2 Homo sapiens hepatic stellate cell line lx-2 lx-2 human hepatic stellate cell line lx-2 8 autoradiography autoradiography western blot western blot Immuno blot Immuno blot unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3d