IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Upstream stimulating factors regulate the expression of RORγT in human lymphocytes. Upstream stimulating factors regulate the expression of RORγT in human lymphocytes. J. Immunol. (0022-1767) 2012 imex curation Ratajewski M., Walczak-Drzewiecka A., Salkowska A., Dastych J. IBD - Inflammatory bowel disease jdastych@cbm.pan.pl 22-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-jurkat Homo sapiens jurkat Human T cell leukemia ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Ratajewski M., Walczak-Drzewiecka A., Salkowska A., Dastych J. IBD - Inflammatory bowel disease jdastych@cbm.pan.pl Accepted 2015-JAN-19 by MGT J. Immunol. (0022-1767) 2012 Only protein-protein interactions imex curation Upstream stimulating factors regulate the expression of RORγT in human lymphocytes. Upstream stimulating factors regulate the expression of RORγT in human lymphocytes. J. Immunol. (0022-1767) 2012 imex curation Ratajewski M., Walczak-Drzewiecka A., Salkowska A., Dastych J. IBD - Inflammatory bowel disease jdastych@cbm.pan.pl 22-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag fluorescence tag visualisation by fluorescence tag fluorescence Ratajewski M., Walczak-Drzewiecka A., Salkowska A., Dastych J. IBD - Inflammatory bowel disease jdastych@cbm.pan.pl Accepted 2015-JAN-19 by MGT J. Immunol. (0022-1767) 2012 Only protein-protein interactions imex curation rorg_human_ebox2_dna-probe RORG promoter USF binding site E-box 2 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CCCAGATTGGCCACGTGGGGCGCCTGTCATCCT usf1_human Upstream stimulatory factor 1 Major late transcription factor 1 USF1 USF BHLHB11 Class B basic helix-loop-helix protein 11 protein protein human Homo sapiens Human MKGQQKTAETEEGTVQIQEGAVATGEDPTSVAIASIQSAATFPDPNVKYVFRTENGGQVMYRVIQVSEGQLDGQTEGTGAISGYPATQSMTQAVIQGAFTSDDAVDTEGTAAETHYTYFPSTAVGDGAGGTTSGSTAAVVTTQGSEALLGQATPPGTGQFFVMMSPQEVLQGGSQRSIAPRTHPYSPKSEAPRTTRDEKRRAQHNEVERRRRDKINNWIVQLSKIIPDCSMESTKSGQSKGGILSKACDYIQELRQSNHRLSEELQGLDQLQLDNDVLRQQVEDLKNKNLLLRAQLRHHGLEVVIKNDSN BFDA91519B4B80AE rorg_human_ebox4_dna-probe RORG promoter USF binding site E-box 4 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human TCCACAGGGTGTCAGGTGGCACATGCCACCACC rorg_human_ebox1_dna-probe RORG promoter USF binding site E-box 1 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GGTGGGGGGTTGTCACTTGGCCACCTGTGTGGT rorg_human_gene Nuclear receptor ROR-gamma (RORC) human gene gene gene human Homo sapiens Human rorg_human_ebox3_dna-probe RORG promoter USF binding site E-box 3 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GTCCCTGAAGTCACCTGGCAAAGAGGGTCAGGC usf2_human Upstream stimulatory factor 2 USF2 Upstream transcription factor 2 FOS-interacting protein Major late transcription factor 2 BHLHB12 Class B basic helix-loop-helix protein 12 protein protein human Homo sapiens Human MDMLDPGLDPAASATAAAAASHDKGPEAEEGVELQEGGDGPGAEEQTAVAITSVQQAAFGDHNIQYQFRTETNGGQVTYRVVQVTDGQLDGQGDTAGAVSVVSTAAFAGGQQAVTQVGVDGAAQRPGPAAASVPPGPAAPFPLAVIQNPFSNGGSPAAEAVSGEARFAYFPASSVGDTTAVSVQTTDQSLQAGGQFYVMMTPQDVLQTGTQRTIAPRTHPYSPKIDGTRTPRDERRRAQHNEVERRRRDKINNWIVQLSKIIPDCNADNSKTGASKGGILSKACDYIRELRQTNQRMQETFKEAERLQMDNELLRQQIEELKNENALLRAQLQQHNLEMVGEGTRQ 78CEFE97AC4C10CF usf1-rorg-1 1 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 4 unspecified role unspecified role bait bait association association Fig. 5e P22415 increases expression at RNA level of ENSG00000143365 usf2-rorg-1 1 9 unspecified role unspecified role bait bait 7 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 5e Q15853 increases expression at RNA level of ENSG00000143365 rorg-usf2-3 2 5 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia physical association physical association Fig. 5a rorg-usf1-3 2 4 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia 8 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 5b rorg-usf1-1 2 3 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia physical association physical association Fig. 5c rorg-usf2-1 2 9 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia 3 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 5c rorg-usf2-2 2 6 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia physical association physical association Fig. 5d rorg-usf1-2 2 4 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia 6 unspecified role unspecified role bait bait region fluorescent dye fluorescent dye label fluorescent dye undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 5d