IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease aribasu@vet.upenn.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis aribasu@vet.upenn.edu Accepted 2014-DEC-17 by ORCHARD J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease aribasu@vet.upenn.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis aribasu@vet.upenn.edu Accepted 2014-DEC-17 by ORCHARD J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). Expression and functional characterization of guanylyl cyclase C receptor in HepG2 cells: Two-step regulation by dexamethasone and hepatocyte nuclear factor 4 (HNF4). J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease aribasu@vet.upenn.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-t84 Homo sapiens colon carcinoma t84 human colon carcinoma ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Basu A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis aribasu@vet.upenn.edu Accepted 2014-DEC-17 by ORCHARD J. Steroid Biochem. Mol. Biol. (0960-0760) 2012 imex curation guc2c_human_hnf4-site_dna-probe Human GUC2C gene promoter HNF4 binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CAAAGTGAACTTTGGTTTATCTCCTGCCATA guc2c_human_gene Heat-stable enterotoxin receptor (GUC2C) human gene gene gene human Homo sapiens Human hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF guc2c-hnf4a-1 2 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). physical association physical association Fig. 3 guc2c-guc2c-1 2 4 competitor competitor competitor prey prey t12g_t13c_g14a mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 6 unspecified role unspecified role prey prey human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). association association Fig. 3 hnf4a-guc2c-2 1 6 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 4b, 6 dexamethasone (CHEBI:41879) (100 micromolar for 48 hours) CHEBI:41879 increases binding of P41235 to ENSG00000070019 CHEBI:41879 indirectly increases expression at RNA level of ENSG00000070019 hnf4a-guc2c-1 3 6 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 4c