IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 imex curation Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease liudp@pumc.edu.cn 12-Nov-2014: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The HNF4alpha construct is described in PMID:2279702. liudp@pumc.edu.cn Accepted 2014-OCT-30 by ORCHARD Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 Only protein-protein interactions imex curation Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 imex curation Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease liudp@pumc.edu.cn 12-Nov-2014: Contacted by IntAct-Help. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis liudp@pumc.edu.cn Accepted 2014-OCT-30 by ORCHARD Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 Only protein-protein interactions imex curation Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Two novel cis-elements involved in hepatocyte nuclear factor 4α regulation of acyl-coenzyme A:cholesterol acyltransferase 2 expression. Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 imex curation Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease liudp@pumc.edu.cn 12-Nov-2014: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Zhang Z., Liu J., Xi Y., Yang R., Chen H., Li Z., Liu D., Liang C. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis The HNF4alpha construct is described in PMID:2279702. liudp@pumc.edu.cn Accepted 2014-OCT-30 by ORCHARD Acta Biochim. Biophys. Sin. (Shanghai) (1672-9145) 2012 Only protein-protein interactions imex curation hnf4a_rat Hepatocyte nuclear factor 4-alpha Hnf4a Hnf-4 Hnf4 Nr2a1 Tcf14 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 Transcription factor HNF-4 protein protein rat Rattus norvegicus (Rat) Rat MRLSKTLADMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGANLNSSNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSQQITSPISGINGDIRAKKIANITDVCESMKEQLLVLVEWAKYIPAFCELLLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYACLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSASDAPHAHHPLHPHLMQEHMGTNVIVANTMPSHLSNGQMCEWPRPRGQAATPETPQPSPPSGSGSESYKLLPGAITTIVKPPSAIPQPTITKQEAI E6DECA74FEA65E75 soat2_human_hnf4a-site2_dna-probe SOAT2 promoter HNF4a regulatory cis-element SII DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CTGAAAGGACTTTAGTCTTTGG hnf4a_human Hepatocyte nuclear factor 4-alpha Transcription factor HNF-4 Nuclear receptor subfamily 2 group A member 1 Transcription factor 14 HNF4A HNF4 NR2A1 TCF14 protein protein human Homo sapiens Human MRLSKTLVDMDMADYSAALDPAYTTLEFENVQVLTMGNDTSPSEGTNLNAPNSLGVSALCAICGDRATGKHYGASSCDGCKGFFRRSVRKNHMYSCRFSRQCVVDKDKRNQCRYCRLKKCFRAGMKKEAVQNERDRISTRRSSYEDSSLPSINALLQAEVLSRQITSPVSGINGDIRAKKIASIADVCESMKEQLLVLVEWAKYIPAFCELPLDDQVALLRAHAGEHLLLGATKRSMVFKDVLLLGNDYIVPRHCPELAEMSRVSIRILDELVLPFQELQIDDNEYAYLKAIIFFDPDAKGLSDPGKIKRLRSQVQVSLEDYINDRQYDSRGRFGELLLLLPTLQSITWQMIEQIQFIKLFGMAKIDNLLQEMLLGGSPSDAPHAHHPLHPHLMQEHMGTNVIVANTMPTHLSNGQMCEWPRPRGQAATPETPQPSPPGGSGSEPYKLLPGAVATIVKPLSAIPQPTITKQEVI 5F1309B89D95DCAF apoc3_human_hnf4a-site_dna-probe APOC3 promoter HNF4a regulatory cis-element DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GCGCTGGGCAAAGGTCACCTGC soat2_human_hnf4a-site1_dna-probe SOAT2 promoter HNF4a regulatory cis-element SI DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AACACTGATCTTTGGACACAAA a1at_human_gene Human alpha-1-antitrypsin (A1AT) gene gene gene human Homo sapiens Human soat2_human_gene Human sterol O-acyltransferase 2 (SOAT2) gene gene gene human Homo sapiens Human acat2-hnf4a-2 3 8 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 3a acat2-hnf4a-1 1 8 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined aacactg-to-aacacgt mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 3a hnf4a-soat2-1 2 10 unspecified role unspecified role prey prey promoter region site-1 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region site-2 binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait association association Fig. 3b P41235 increases expression at RNA level of ENSG00000167780 soat2-hnf4a-2 1 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ctgaaaggacttt-to-ctgaaaggatccc mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 3a apoc3-hnf4a-3 1 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. 7 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 3a soat2-hnf4a-1 3 5 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 3a apoc3-hnf4a-1 3 7 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 4 unspecified role unspecified role prey prey region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. physical association physical association Fig. 3a hnf4a-a1at-1 2 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3b