IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. Nature immunology 2011 imex curation Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! raysolfc@rcai.riken.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! raysolfc@rcai.riken.jp Accepted 2017-JAN-26 AT 12:41 GMT AT 12:41 GMT by PPORRAS Nature immunology 2011 Only protein-protein interactions imex curation imex curation The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. Nature immunology 2011 imex curation Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! raysolfc@rcai.riken.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell_th1 Mouse T helper cell Th1 t-cell_th1 T-helper cell 1 ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! R4 TH1 cells:- TH1 cells given four rounds (R4) of simulation with mAb to TCR-beta and mAb to CD28 and then restimulated with mAb to TCR-beta. raysolfc@rcai.riken.jp Accepted 2017-JAN-26 AT 12:41 GMT AT 12:41 GMT by PPORRAS Nature immunology 2011 Only protein-protein interactions imex curation imex curation The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. The transcription factor E4BP4 regulates the production of IL-10 and IL-13 in CD4+ T cells. Nature immunology 2011 imex curation Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! raysolfc@rcai.riken.jp 21-Mar-2017: Contacted by IntAct-Help. Only protein-protein interactions imex curation mouse-t-cell_th2 mouse helper T-lymphocyte Th2 Mouse t-cell_th2 T-helper cell 2 ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Motomura Y., Kitamura H., Hijikata A., Matsunaga Y., Matsumoto K., Inoue H., Atarashi K., Hori S., Watarai H., Zhu J., Taniguchi M., Kubo M. IBD - Inflammatory bowel disease No results have been entered from assays using antibodies to Histone-H3, due to lack of antibody specificity. Fig 2E does not show colocalisation! raysolfc@rcai.riken.jp Accepted 2017-JAN-26 AT 12:41 GMT AT 12:41 GMT by PPORRAS Nature immunology 2011 Only protein-protein interactions imex curation imex curation il13_mouse_gene Interleukin-13 Il13 Il-13 gene gene mouse Mus musculus Mouse il10_mouse_gene Interleukin-10 gene gene gene mouse Mus musculus Mouse il13_promoter_probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid mouse Mus musculus Mouse CCATCTCCCGTTACATAAGGCCGCGCCTCT nfil3_mouse Nuclear factor interleukin-3-regulated protein Nfil3 E4bp4 E4 promoter-binding protein 4 Embryo implantation-related NFIL3/E4BP4-like transcription factor protein protein mouse Mus musculus Mouse MQLRKMQTIKKEPAPLDPTSSSDKMLLLNSALAEVAEDLASGEDLLLNEGSMGKNKSSACRRKREFIPDEKKDAMYWEKRRKNNEAAKRSREKRRLNDLVLENKLIALGEENATLKAELLSLKLKFGLISSTAYAQEIQKLSNSTAVYFQDYQTSKAAVSSFVDEHEPAMVAGSCISVIKHSPQSSLSDVSEVSSVEHTQESPAQGGCRSPENKFPVIKQEPVELESFAREAREERGTYSTSIYQSYMGSSFSTYSHSPPLLQVHGSTSNSPRTSEADEGVVGKSSDGEDEQQVPKGPIHSPVELQRVHATVVKVPEVNPSALPHKLRIKAKAMQVKVEALDSEFEGMQKLSSPADAIAKRHFDLEKHGTSGMAHSSLPPFSVQVTNIQDWSLKSEHWHHKELSSKTQSSFKTGVVEVKDGGYKVSEAENLYLKQGIANLSAEVVSLKRFIATQPISASDSR DC711EB4CAC0112E nfil3-il13-1 2 4 unspecified role unspecified role prey prey promoter_region_HS1_site sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association 7B There was binding of E4BP4 to the HS1 site in R4 TH1 cells but not in conventional TH1 cells. O08750 increases the expression at protein level of ENSMUSG00000020383 O08750 increases the expression at RNA level of ENSMUSG00000020383 caus. from Fig 2 + Supp Fig 2 and 3 - unfortunately I cannot find Supp Fig 3 and Fig 2 appears to have no text... nfil3-il10_mouse_gene-1 3 5 unspecified role unspecified role prey prey regions_including_3-prime_non-coding_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role bait bait association association 7D The text states that "E4BP4 bound to intron 4 and the 3′ noncoding region of the Il10 locus (Fig. 7d)"- however this is not shown in fig 7D - in intron 4 the binding appears to dip and is much higher further upstream - though it is hard to say from the figure exactly where; hence I have entered the feature as "regions". il13_promoter_probe-nfil3-1 1 7 unspecified role unspecified role prey prey mouse-t-cell_th2 mouse helper T-lymphocyte Th2 Mouse t-cell_th2 T-helper cell 2 6 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association 7C