IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis HEK-293 cells transfected with human or mouse TLR4, MD2 and CD14 genes (Invivogen) were used. i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-mddc Human Monocyte-derived dendritic cell monocyte-derived_dendritic_cell Monocyte-derived dendritic cell (MDDC) ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis HEK-293 cells transfected with human or mouse TLR4, MD2 and CD14 genes (Invivogen) were used. i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis HEK-293 cells transfected with human or mouse TLR4, MD2 and CD14 genes (Invivogen) were used. i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation IRF5 is required for late-phase TNF secretion by human dendritic cells. IRF5 is required for late-phase TNF secretion by human dendritic cells. Blood (0006-4971) 2010 imex curation Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis IBD - Inflammatory bowel disease i.udalova@imperial.ac.uk 26-Feb-2015: Contacted by IntAct-Help. Only protein-protein interactions human-mddc Human Monocyte-derived dendritic cell monocyte-derived_dendritic_cell Monocyte-derived dendritic cell (MDDC) anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Krausgruber T., Saliba D., Ryzhakov G., Lanfrancotti A., Blazek K., Udalova I.A. Ulcerative colitis - Interactions of proteins identified as having a link to ulcerative colitis i.udalova@imperial.ac.uk Accepted 2015-JAN-26 by ORCHARD Blood (0006-4971) 2010 Only protein-protein interactions imex curation tnfa_human_gene Tumor necrosis factor TNF TNFA TNFSF2 Cachectin TNF-alpha Tumor necrosis factor ligand superfamily member 2 gene gene human Homo sapiens Human tnfa_human_isre1_dna-probe Human TNFA gene promoter IFN-sensitive response element 1 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGCTGAAGCCAAGACTGAAACCAGCATTA irf5_human Interferon regulatory factor 5 IRF5 protein protein human Homo sapiens Human MNQSIPVAPTPPRRVRLKPWLVAQVNSCQYPGLQWVNGEKKLFCIPWRHATRHGPSQDGDNTIFKAWAKETGKYTEGVDEADPAKWKANLRCALNKSRDFRLIYDGPRDMPPQPYKIYEVCSNGPAPTDSQPPEDYSFGAGEEEEEEEELQRMLPSLSLTEDVKWPPTLQPPTLRPPTLQPPTLQPPVVLGPPAPDPSPLAPPPGNPAGFRELLSEVLEPGPLPASLPPAGEQLLPDLLISPHMLPLTDLEIKFQYRGRPPRALTISNPHGCRLFYSQLEATQEQVELFGPISLEQVRFPSPEDIPSDKQRFYTNQLLDVLDRGLILQLQGQDLYAIRLCQCKVFWSGPCASAHDSCPNPIQREVKTKLFSLEHFLNELILFQKGQTNTPPPFEIFFCFGEEWPDRKPREKKLITVQVVPVAARLLLEMFSGELSWSADSIRLQISNPDLKDRMVEQFKELHHIWQSQQRLQPVAQAPPGAGLGVGQGPWPMHPAGMQ DIP protein Q13568 original sequence version: 67 01B2ED95C28384E8 tf65_human Transcription factor p65 Nuclear factor NF-kappa-B p65 subunit RELA NFKB3 Nuclear factor of kappa light polypeptide gene enhancer in B-cells 3 protein protein human Homo sapiens Human MDELFPLIFPAEPAQASGPYVEIIEQPKQRGMRFRYKCEGRSAGSIPGERSTDTTKTHPTIKINGYTGPGTVRISLVTKDPPHRPHPHELVGKDCRDGFYEAELCPDRCIHSFQNLGIQCVKKRDLEQAISQRIQTNNNPFQVPIEEQRGDYDLNAVRLCFQVTVRDPSGRPLRLPPVLSHPIFDNRAPNTAELKICRVNRNSGSCLGGDEIFLLCDKVQKEDIEVYFTGPGWEARGSFSQADVHRQVAIVFRTPPYADPSLQAPVRVSMQLRRPSDRELSEPMEFQYLPDTDDRHRIEEKRKRTYETFKSIMKKSPFSGPTDPRPPPRRIAVPSRSSASVPKPAPQPYPFTSSLSTINYDEFPTMVFPSGQISQASALAPAPPQVLPQAPAPAPAPAMVSALAQAPAPVPVLAPGPPQAVAPPAPKPTQAGEGTLSEALLQLQFDDEDLGALLGNSTDPAVFTDLASVDNSEFQQLLNQGIPVAPHTTEPMLMEYPEAITRLVTGAQRPPDPAPAPLGAPGLPNGLLSGDEDFSSIADMDFSALLSQISS DIP protein Q04206 original sequence version: 170 DIP protein Q04206 original sequence version: 173 DIP protein Q04206 original sequence version: 99 DIP protein Q04206-1 original sequence version: 99 DIP protein Q04206 original sequence version: 168 DIP protein Q04206 original sequence version: 128 DIP protein Q04206 original sequence version: 131 DIP protein Q04206 original sequence version: 153 DIP protein Q04206 original sequence version: 185 DIP protein Q04206 original sequence version: 181 DIP protein Q04206 original sequence version: 183 8147A6AF9F2445C6 tnfa_human_isre5_dna-probe Human TNFA gene promoter IFN-sensitive response element 5 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGCTGGAGAAGAAACCGAGACAGAAGGTG rpb1_human DNA-directed RNA polymerase II subunit RPB1 POLR2A DNA-directed RNA polymerase II subunit A DNA-directed RNA polymerase III largest subunit POLR2 RNA-directed RNA polymerase II subunit RPB1 protein protein human Homo sapiens Human MHGGGPPSGDSACPLRTIKRVQFGVLSPDELKRMSVTEGGIKYPETTEGGRPKLGGLMDPRQGVIERTGRCQTCAGNMTECPGHFGHIELAKPVFHVGFLVKTMKVLRCVCFFCSKLLVDSNNPKIKDILAKSKGQPKKRLTHVYDLCKGKNICEGGEEMDNKFGVEQPEGDEDLTKEKGHGGCGRYQPRIRRSGLELYAEWKHVNEDSQEKKILLSPERVHEIFKRISDEECFVLGMEPRYARPEWMIVTVLPVPPLSVRPAVVMQGSARNQDDLTHKLADIVKINNQLRRNEQNGAAAHVIAEDVKLLQFHVATMVDNELPGLPRAMQKSGRPLKSLKQRLKGKEGRVRGNLMGKRVDFSARTVITPDPNLSIDQVGVPRSIAANMTFAEIVTPFNIDRLQELVRRGNSQYPGAKYIIRDNGDRIDLRFHPKPSDLHLQTGYKVERHMCDGDIVIFNRQPTLHKMSMMGHRVRILPWSTFRLNLSVTTPYNADFDGDEMNLHLPQSLETRAEIQELAMVPRMIVTPQSNRPVMGIVQDTLTAVRKFTKRDVFLERGEVMNLLMFLSTWDGKVPQPAILKPRPLWTGKQIFSLIIPGHINCIRTHSTHPDDEDSGPYKHISPGDTKVVVENGELIMGILCKKSLGTSAGSLVHISYLEMGHDITRLFYSNIQTVINNWLLIEGHTIGIGDSIADSKTYQDIQNTIKKAKQDVIEVIEKAHNNELEPTPGNTLRQTFENQVNRILNDARDKTGSSAQKSLSEYNNFKSMVVSGAKGSKINISQVIAVVGQQNVEGKRIPFGFKHRTLPHFIKDDYGPESRGFVENSYLAGLTPTEFFFHAMGGREGLIDTAVKTAETGYIQRRLIKSMESVMVKYDATVRNSINQVVQLRYGEDGLAGESVEFQNLATLKPSNKAFEKKFRFDYTNERALRRTLQEDLVKDVLSNAHIQNELEREFERMREDREVLRVIFPTGDSKVVLPCNLLRMIWNAQKIFHINPRLPSDLHPIKVVEGVKELSKKLVIVNGDDPLSRQAQENATLLFNIHLRSTLCSRRMAEEFRLSGEAFDWLLGEIESKFNQAIAHPGEMVGALAAQSLGEPATQMTLNTFHYAGVSAKNVTLGVPRLKELINISKKPKTPSLTVFLLGQSARDAERAKDILCRLEHTTLRKVTANTAIYYDPNPQSTVVAEDQEWVNVYYEMPDFDVARISPWLLRVELDRKHMTDRKLTMEQIAEKINAGFGDDLNCIFNDDNAEKLVLRIRIMNSDENKMQEEEEVVDKMDDDVFLRCIESNMLTDMTLQGIEQISKVYMHLPQTDNKKKIIITEDGEFKALQEWILETDGVSLMRVLSEKDVDPVRTTSNDIVEIFTVLGIEAVRKALERELYHVISFDGSYVNYRHLALLCDTMTCRGHLMAITRHGVNRQDTGPLMKCSFEETVDVLMEAAAHGESDPMKGVSENIMLGQLAPAGTGCFDLLLDAEKCKYGMEIPTNIPGLGAAGPTGMFFGSAPSPMGGISPAMTPWNQGATPAYGAWSPSVGSGMTPGAAGFSPSAASDASGFSPGYSPAWSPTPGSPGSPGPSSPYIPSPGGAMSPSYSPTSPAYEPRSPGGYTPQSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPSYSPTSPNYSPTSPNYTPTSPSYSPTSPSYSPTSPNYTPTSPNYSPTSPSYSPTSPSYSPTSPSYSPSSPRYTPQSPTYTPSSPSYSPSSPSYSPASPKYTPTSPSYSPSSPEYTPTSPKYSPTSPKYSPTSPKYSPTSPTYSPTTPKYSPTSPTYSPTSPVYTPTSPKYSPTSPTYSPTSPKYSPTSPTYSPTSPKGSTYSPTSPGYSPTSPTYSLTSPAISPDDSDEEN DIP protein P24928 original sequence version: 108 DIP protein P24928 original sequence version: 147 DIP protein P24928 original sequence version: 158 DIP protein P24928 original sequence version: 157 DIP protein P24928 original sequence version: 179 DIP protein P24928 original sequence version: 181 DIP protein P24928 original sequence version: 161 DIP protein P24928 original sequence version: 175 DIP protein P24928-1 original sequence version: 175 DIP protein P24928 original sequence version: 68 DIP protein P24928 original sequence version: 116 28D6FD25693A6472 ifnb_human_prd1-3_dna-probe Human IFNB gene promoter positive regulatory domain 1-3 DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human AGCTGGGAAACTGAAAGGGAAAGTGAAAGTGG irf5-rela 5 9 unspecified role unspecified role bait bait nucl transfection nucleic acid transfection nucl transfection c-terminus ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range n-terminus one-strep-tag one-strep-tag twin-strep-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range 10 unspecified role unspecified role prey prey naturally occurring naturally occurring endogenous endogenous physical association physical association Fig. 4a rela-irf5 5 9 unspecified role unspecified role prey prey naturally occurring naturally occurring endogenous endogenous 10 unspecified role unspecified role bait bait nucl transfection nucleic acid transfection nucl transfection c-terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged c-term range C-terminal range c-term range c-term range C-terminal range c-term range physical association physical association Fig. 4b irf5-rela-1 1 10 unspecified role unspecified role prey prey naturally occurring naturally occurring endogenous endogenous 9 unspecified role unspecified role bait bait naturally occurring naturally occurring endogenous endogenous physical association physical association Fig. 4d lipopolysaccharide (LPS) (CHEBI:16412) Extracted nuclei were treated with DNaseI prior to the co-immunoprecipitation experiment, indicating that the interaction between IRF5 and p65 is independent of simultaneous binding of the proteins to DNA. irf5-rela-2 6 9 unspecified role unspecified role bait bait naturally occurring naturally occurring endogenous endogenous 10 unspecified role unspecified role prey prey naturally occurring naturally occurring endogenous endogenous physical association physical association Fig. 4c lipopolysaccharide (LPS) (CHEBI:16412) irf5-tnf 4 7 unspecified role unspecified role prey prey promoter region b binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region c binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region g binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region h binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region a binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 9 unspecified role unspecified role bait bait association association Fig. 3b, 5c, Suppl. fig. S4 lipopolysaccharide (LPS) (CHEBI:16412) anti-p65/RelA siRNA rela-tnf-1 4 7 unspecified role unspecified role prey prey promoter region b binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region e binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region h binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait association association Fig. 3c, 5b lipopolysaccharide (LPS) (CHEBI:16412) anti-p65/RelA siRNA rela-tnf-2 3 10 unspecified role unspecified role bait bait 7 unspecified role unspecified role prey prey promoter region e binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region h binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region b binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3e, 3f, Suppl. fig. S3c lipopolysaccharide (LPS) (CHEBI:16412) Q04206 increases expression at RNA level of ENSG00000204490 CHEBI:16412 increases binding of Q04206 to ENSG00000204490 irf5-tnf-1 3 9 unspecified role unspecified role bait bait 7 unspecified role unspecified role prey prey promoter region b binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region h binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Fig. 3d, 3f, Suppl. fig. S3b lipopolysaccharide (LPS) (CHEBI:16412) CHEBI:16412 indirectly increases expression at RNA level of ENSG00000204490 CHEBI:16412 indirectly increases expression at protein level of ENSG00000204490 Q13568 increases expression at RNA level of ENSG00000204490 Q13568 increases expression at protein level of ENSG00000204490 Q04206 increases binding of Q13568 to ENSG00000204490 CHEBI:16412 increases binding of Q13568 to ENSG00000204490 polr2a-tnf 3 12 unspecified role unspecified role bait bait 7 unspecified role unspecified role prey prey promoter region h binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter region 5-prime tss binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Suppl. fig. S3d, S6 lipopolysaccharide (LPS) (CHEBI:16412) CHEBI:16412 increases binding of P24928 to ENSG00000204490 tnfa-irf5 2 8 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 9 unspecified role unspecified role prey prey interferon_reg_fact_dna-bd_dom sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecolx Escherichia coli direct interaction direct interaction Suppl. fig. S3a tnfa-irf5-1 2 9 unspecified role unspecified role prey prey interferon_reg_fact_dna-bd_dom sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecolx Escherichia coli 11 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Suppl. fig. S3a ifnb-irf5 2 9 unspecified role unspecified role prey prey interferon_reg_fact_dna-bd_dom required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain ecolx Escherichia coli 13 unspecified role unspecified role bait bait dctp 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction Suppl. fig. S3a