IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. Journal of immunology (Baltimore, Md. : 1950) 2010 imex curation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift tag visualisation tag visualisation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease I have not altered the "probe" as the sequence is the same for Pull Down and EMSA - still called an "oligo" as well. Methods section state that:- EMSA were performed as described by Schreiber et al (11).". However the word "EMSA" is not mentioned in ref. 11, neither does this reference have Schreiber as first or any author. Several sources refer to an EMSA assay in relation to a "Schreiber"; these use 32P labeled probes. Participant detection has been entered here as "Tag Visualisation" as the exact method used is not known. xim2002@med.cornell.edu Accepted 2015-DEC-09 AT 13:19 GMT AT 13:19 GMT by ORCHARD Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. Journal of immunology (Baltimore, Md. : 1950) 2010 imex curation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease I have taken the 1082A sequence as the "WT" as this is found in the UCSC brower (+ presumably Ensembl hg38 assembly) xim2002@med.cornell.edu Accepted 2015-DEC-09 AT 13:19 GMT AT 13:19 GMT by ORCHARD Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. Journal of immunology (Baltimore, Md. : 1950) 2010 imex curation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation human-monocyte Human mononuclear cells monocyte Monocyte, mononuclear cell ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease PBMC (Peripheral blood mononuclear cells)-derived monocytes. xim2002@med.cornell.edu Accepted 2015-DEC-09 AT 13:19 GMT AT 13:19 GMT by ORCHARD Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. The septic shock-associated IL-10 -1082 A > G polymorphism mediates allele-specific transcription via poly(ADP-Ribose) polymerase 1 in macrophages engulfing apoptotic cells. Journal of immunology (Baltimore, Md. : 1950) 2010 imex curation Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu 19-Jan-2016: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Kang X., Kim HJ., Ramirez M., Salameh S., Ma X. IBD - Inflammatory bowel disease xim2002@med.cornell.edu Accepted 2015-DEC-09 AT 13:19 GMT AT 13:19 GMT by ORCHARD Journal of immunology (Baltimore, Md. : 1950) 2010 Only protein-protein interactions imex curation imex curation il10_human_gene Interleukin-10 (IL10) human gene gene gene human Homo sapiens Human parp1_human Poly [ADP-ribose] polymerase 1 PARP1 ADPRT PPOL NAD(+) ADP-ribosyltransferase 1 Poly[ADP-ribose] synthase 1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein human Homo sapiens Human MAESSDKLYRVEYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGHSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVTGKGQDGIGSKAEKTLGDFAAEYAKSNRSTCKGCMEKIEKGQVRLSKKMVDPEKPQLGMIDRWYHPGCFVKNREELGFRPEYSASQLKGFSLLATEDKEALKKQLPGVKSEGKRKGDEVDGVDEVAKKKSKKEKDKDSKLEKALKAQNDLIWNIKDELKKVCSTNDLKELLIFNKQQVPSGESAILDRVADGMVFGALLPCEECSGQLVFKSDAYYCTGDVTAWTKCMVKTQTPNRKEWVTPKEFREISYLKKLKVKKQDRIFPPETSASVAATPPPSTASAPAAVNSSASADKPLSNMKILTLGKLSRNKDEVKAMIEKLGGKLTGTANKASLCISTKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQELFLAHILSPWGAEVKAEPVEVVAPRGKSGAALSKKSKGQVKEEGINKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKENRYWIFRSWGRVGTVIGSNKLEQMPSKEDAIEHFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVNPGTKSKLPKPVQDLIKMIFDVESMKKAMVEYEIDLQKMPLGKLSKRQIQAAYSILSEVQQAVSQGSSDSQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEIIRKYVKNTHATTHNAYDLEVIDIFKIEREGECQRYKPFKQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLILLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSANISLDGVDVPLGTGISSGVNDTSLLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW DIP protein P09874 original sequence version: 189 DIP protein P09874 original sequence version: 183 DIP protein P09874 original sequence version: 166 DIP protein P09874 original sequence version: 117 DIP protein P09874 original sequence version: 143 DIP protein P09874 original sequence version: 136 DIP protein P09874 original sequence version: 137 DIP protein P09874 original sequence version: 147 DIP protein P09874 original sequence version: 193 DIP protein P09874 original sequence version: 202 DIP protein P09874 original sequence version: 171 DIP protein P09874 original sequence version: 153 DIP protein P09874 original sequence version: 175 6A5FC01EB91C046B 1082a_oligo_il10_promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human TTCTTTGGGAAGGGGAAGTA parp1_mouse Poly [ADP-ribose] polymerase 1 Poly[ADP-ribose] synthase 1 NAD(+) ADP-ribosyltransferase 1 Parp1 Adprp Adprt Adprt1 ADP-ribosyltransferase diphtheria toxin-like 1 DNA ADP-ribosyltransferase PARP1 Protein poly-ADP-ribosyltransferase PARP1 protein protein mouse Mus musculus Mouse MAEASERLYRVQYAKSGRASCKKCSESIPKDSLRMAIMVQSPMFDGKVPHWYHFSCFWKVGQSIRHPDVEVDGFSELRWDDQQKVKKTAEAGGVAGKGQDGSGGKAEKTLGDFAAEYAKSNRSMCKGCLEKIEKGQMRLSKKMVDPEKPQLGMIDRWYHPTCFVKKRDELGFRPEYSASQLKGFSLLSAEDKEALKKQLPAIKNEGKRKGDEVDGTDEVAKKKSRKETDKYSKLEKALKAQNELIWNIKDELKKACSTNDLKELLIFNQQQVPSGESAILDRVADGMAFGALLPCKECSGQLVFKSDAYYCTGDVTAWTKCMVKTQNPSRKEWVTPKEFREISYLKKLKVKKQDRIFPPESSAPITVHWPLSVTSAPTAVNSSAPADKPLSNMKILTLGKLSQNKDEAKAVIEKLGGKLTGSANKASLCISIKKEVEKMNKKMEEVKEANIRVVSEDFLQDVSASTKSLQDLLSAHSLSPWGAEVKAEPGEVVAPRGKSAAPSKKSKGCFKEEGVNKSEKRMKLTLKGGAAVDPDSGLEHSAHVLEKGGKVFSATLGLVDIVKGTNSYYKLQLLEDDKESRYWIFRSWGRLGTVIGSNKLEQMPSKEEAVEQFMKLYEEKTGNAWHSKNFTKYPKKFYPLEIDYGQDEEAVKKLTVKPGTKSKLPKPVQELVGMIFDVDSMKKALVEYEIDLQKMPLGKLSRRQIQAAYSILSEVQQPVSQGSSESQILDLSNRFYTLIPHDFGMKKPPLLNNADSVQAKVEMLDNLLDIEVAYSLLRGGSDDSSKDPIDVNYEKLKTDIKVVDRDSEEAEVIRKYVKNTHATTHNAYDLEVIDIFKIEREGESQRYKPFRQLHNRRLLWHGSRTTNFAGILSQGLRIAPPEAPVTGYMFGKGIYFADMVSKSANYCHTSQGDPIGLIMLGEVALGNMYELKHASHISKLPKGKHSVKGLGKTTPDPSASITLEGVEVPLGTGIPSGVNDTALLYNEYIVYDIAQVNLKYLLKLKFNFKTSLW DIP protein P11103 original sequence version: 122 DIP protein P11103 original sequence version: 163 DIP protein P11103 original sequence version: 164 5E54C3E5F60BB922 1082a_oligo_il10_promoter-parp1-1 2 7 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A G region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association 3A 1082a_oligo_il10_promoter-parp1-2 2 7 unspecified role unspecified role bait bait region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A G 8 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association 3Ai 1082a_oligo_il10_promoter-parp1-3 4 7 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A G region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association 3B 1082a_oligo_il10_promoter-parp1-4 4 7 unspecified role unspecified role bait bait A11G mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain A G region biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association 3B 1082a_oligo_il10_promoter-parp1-5 1 7 unspecified role unspecified role bait bait possible _tag_or _radiolabel biotin tag biotin tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role prey prey human-mono_mac6 human Acute monocytic leukemia derived cell line Human mono_mac6 physical association physical association 3B 1082a_oligo_il10_promoter-parp1-6 1 7 unspecified role unspecified role bait bait possible _tag_or _radiolabel tag tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role prey prey mouse-raw264_7 Mus musculus monocyte macrophage cell line RAW264 raw264_7 Mouse monocyte macrophage cellline RAW264.7 physical association physical association 3B P11103 decreases the expression at RNA level of ENSMUSG00000016529 CHEBI:64042 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 CHEBI:75399 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 CHEBI:42567 and CHEBI:16412 increase the expression at protein level of ENSMUSG00000016529 parp1-il10_human_gene-1 3 6 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6 B/C "ACs" -apoptotic cells CHEBI:42567 and CHEBI:16412 increase the expression at protein level of ENSG00000136634. CHEBI:75399 and CHEBI:16412 increase the expression at protein level of ENSG00000136634 CHEBI:64042 and CHEBI:16412 increase the expression at protein level of ENSG00000136634