DIP Database of Interacting Proteins 611 Young Drive East; Los Angeles CA 90095; USA http://dip.doe-mbi.ucla.edu/ dip@mbi.ucla.edu Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions human-pbmc Human Peripheral Blood Mononuclear cell peripheral_blood_mononuclear_cell Peripheral blood mononuclear cell anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Both Altered to "mouse".; I still think the HA- and FLAg tagged constructs are Human - even if the GST tagged one is Mouse:- 1] Supp Methods "Plasmids" states "The AML1 expression vectors pLNCX-FLAG-AML1 and the deletion constructs have been previously described -ref 6 (16). This is mentioned before the "Mouse AML1 cDNA". Ref 6 text constantly refers to the Human protein and blat of primers confirms this. The vector "pLNCX-FLAG-AML1 is NOT mentioned at all in Ref 6, but similar construct LNSX-FLAG-AML1a/b is mentioned in a later publication by the same author - Kitabayashi -2001. 2] Ref 6 explicilty mentions HA tagged AML1, which is used here. 3] The isoform of "AML1a" or "AML1-DN" referred to above Fig 2 and in Ref 6/16 is not found in Mouse (Uniprot) If you really dont agree I will alter to "mouse". Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions human-jurkat Homo sapiens jurkat Human T cell leukemia ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Both Altered to "mouse".; I still think the HA- and FLAg tagged constructs are Human - even if the GST tagged one is Mouse:- 1] Supp Methods "Plasmids" states "The AML1 expression vectors pLNCX-FLAG-AML1 and the deletion constructs have been previously described -ref 6 (16). This is mentioned before the "Mouse AML1 cDNA". Ref 6 text constantly refers to the Human protein and blat of primers confirms this. The vector "pLNCX-FLAG-AML1 is NOT mentioned at all in Ref 6, but similar construct LNSX-FLAG-AML1a/b is mentioned in a later publication by the same author - Kitabayashi -2001. 2] Ref 6 explicilty mentions HA tagged AML1, which is used here. 3] The isoform of "AML1a" or "AML1-DN" referred to above Fig 2 and in Ref 6/16 is not found in Mouse (Uniprot) If you really dont agree I will alter to "mouse". Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro pull down pull down autoradiography autoradiography Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip anti tag western anti tag western blot anti tag western Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease The origins of FLAG-tagged AML2 and 3 are not mentioned;hence interactions involving these proteins have not been included. shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Both Altered to "mouse".; I still think the HA- and FLAg tagged constructs are Human - even if the GST tagged one is Mouse:- 1] Supp Methods "Plasmids" states "The AML1 expression vectors pLNCX-FLAG-AML1 and the deletion constructs have been previously described -ref 6 (16). This is mentioned before the "Mouse AML1 cDNA". Ref 6 text constantly refers to the Human protein and blat of primers confirms this. The vector "pLNCX-FLAG-AML1 is NOT mentioned at all in Ref 6, but similar construct LNSX-FLAG-AML1a/b is mentioned in a later publication by the same author - Kitabayashi -2001. 2] Ref 6 explicilty mentions HA tagged AML1, which is used here. 3] The isoform of "AML1a" or "AML1-DN" referred to above Fig 2 and in Ref 6/16 is not found in Mouse (Uniprot) If you really dont agree I will alter to "mouse". Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa autoradiography autoradiography Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease The construct that is stated to have been used for EMSA is "pCMV-Tag2-AML1-DN" (DNA binding domain) or "AML1A". From reference 16 and figure 2D (this publication) it has been deduced that AML1-DN/AML1A refers to a shorter isoform of the human protein, of 250 amino acids;it is probably isoform 3 (Q01196-3) as this protein has 250 residues, (but is not Isoform 2 from UniProt entry Q01196 as this isoform (called AML-1A) retains the C-terminal region). There are other human isoforms with a similar length to Q01196-3;however the DNA Binding domain would appear to be retained for most/all isoforms. The species of AML1 (Human) has been verified by a blat of the primers used in Ref 16. shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Both Altered to "mouse".; I still think the HA- and FLAg tagged constructs are Human - even if the GST tagged one is Mouse:- 1] Supp Methods "Plasmids" states "The AML1 expression vectors pLNCX-FLAG-AML1 and the deletion constructs have been previously described -ref 6 (16). This is mentioned before the "Mouse AML1 cDNA". Ref 6 text constantly refers to the Human protein and blat of primers confirms this. The vector "pLNCX-FLAG-AML1 is NOT mentioned at all in Ref 6, but similar construct LNSX-FLAG-AML1a/b is mentioned in a later publication by the same author - Kitabayashi -2001. 2] Ref 6 explicilty mentions HA tagged AML1, which is used here. 3] The isoform of "AML1a" or "AML1-DN" referred to above Fig 2 and in Ref 6/16 is not found in Mouse (Uniprot) If you really dont agree I will alter to "mouse". Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Foxp3 controls regulatory T-cell function by interacting with AML1/Runx1. Nature 2007 imex curation Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease shimon@frontier.kyoto-u.ac.jp 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions mouse-t-cell_cd4+ Mouse CD4 positive T-cell t-cell_cd4+ t cell cd4+ confocal microscopy confocal microscopy immunocytochemistry immunocytochemistry Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S., Ono M., Yaguchi H., Ohkura N., Kitabayashi I., Nagamura Y., Nomura T., Miyachi Y., Tsukada T., Sakaguchi S. IBD - Inflammatory bowel disease TReg cells (CD25+) shimon@frontier.kyoto-u.ac.jp Accepted 2016-AUG-01 AT 11:26 BST AT 11:26 BST by ORCHARD Nature 2007 imex curation Both Altered to "mouse".; I still think the HA- and FLAg tagged constructs are Human - even if the GST tagged one is Mouse:- 1] Supp Methods "Plasmids" states "The AML1 expression vectors pLNCX-FLAG-AML1 and the deletion constructs have been previously described -ref 6 (16). This is mentioned before the "Mouse AML1 cDNA". Ref 6 text constantly refers to the Human protein and blat of primers confirms this. The vector "pLNCX-FLAG-AML1 is NOT mentioned at all in Ref 6, but similar construct LNSX-FLAG-AML1a/b is mentioned in a later publication by the same author - Kitabayashi -2001. 2] Ref 6 explicilty mentions HA tagged AML1, which is used here. 3] The isoform of "AML1a" or "AML1-DN" referred to above Fig 2 and in Ref 6/16 is not found in Mouse (Uniprot) If you really dont agree I will alter to "mouse". q60591-3 Nuclear factor of activated T-cells, cytoplasmic 2 NFAT pre-existing subunit T-cell transcription factor NFAT1 Nfatc2 Nfat1 Nfatp protein protein mouse Mus musculus Mouse MDVPEPQPDPDGGDGPGHEPGGSPQDELDFSILFDYDYLNPIEEEPIAHKAISSPSGLAYPDDVLDYGLKPCNPLASLSGEPPGRFGEPDSIGFQNFLSPVKPAGASGPSPRIEITPSHELMQAGGALRGRDAGLSPEQPALALAGVAASPRFTLPVPGYEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNAGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVAPLPAASPQRSRSPSPQPSPHVALQDDSIPAGYPPTAGSAVLMDALNTLATDSPCGIPSKIWKTSPDPTPVSTAPSKAGLARHIYPTVEFLGPCEQEERRNSAPESILLVPPTWPKQLVPAIPICSIPVTASLPPLEWPLSNQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHVPEPSGRIVSLQAASNPIECSQRSAHELPMVERQDMDSCLVYGGQQMILTGQNFTAESKVVFMEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRVPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPSDEYEPSLICSPAHGGLGSQPYYPQHPMLAESPSCLVATMAPCQQFRSGLSSPDARYQQQSPAAALYQRSKSLSPGLLGYQQPSLLAAPLGLADAHRSVLVHAGSQGQGQGSTLPHTSSASQQASPVIHYSPTNQQLRGGGHQEFQHIMYCENFGPSSARPGPPPINQGQRLSPGAYPTVIQQQTAPSQRAAKNGPSDQKEALPTGVTVKQEQNLDQTYLDDVNEIIRKEFSGPPSRNQT F21E7BABE7DBB40F ctla4_mouse_gene Ctla4 gene gene mouse Mus musculus Mouse re3_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse AAATGGGGTAGGTGTGTGGTGAGGCTTATGTTAA il2ra_mouse_gene Interleukin-2 receptor subunit alpha gene gene gene mouse Mus musculus Mouse runx1_human Runt-related transcription factor 1 RUNX1 AML1 CBFA2 Core-binding factor subunit alpha-2 Acute myeloid leukemia 1 protein Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein human Homo sapiens Human MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDAGAALAGKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDTRQIQPSPPWSYDQSYQYLGSIASPSVHPATPISPGRASGMTTLSAELSSRLSTAPDLTAFSDPRQFPALPSISDPRMHYPGAFTYSPTPVTSGIGIGMSAMGSATRYHTYLPPPYPGSSQAQGGPFQASSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGSALLNPSLPNQSDVVEAEGSHSNSPTNMAPSARLEEAVWRPY DIP protein Q01196 original sequence version: 171 DIP protein Q01196 original sequence version: 189 DIP protein Q01196 original sequence version: 132 4F1F193A7CADDBAB il2_human_gene Human IL-2 gene IL2 gene gene human Homo sapiens Human re1_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse TTGCGTTTGTCCACCACAACAGGCTGCTTAC foxp3_mouse Forkhead box protein P3 Foxp3 Scurfin protein protein mouse Mus musculus Mouse MPNPRPAKPMAPSLALGPSPGVLPSWKTAPKGSELLGTRGSGGPFQGRDLRSGAHTSSSLNPLPPSQLQLPTVPLVMVAPSGARLGPSPHLQALLQDRPHFMHQLSTVDAHAQTPVLQVRPLDNPAMISLPPPSAATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPRSGTPRKDSNLLAAPQGSYPLLANGVCKWPGCEKVFEEPEEFLKHCQADHLLDEKGKAQCLLQREVVQSLEQQLELEKEKLGAMQAHLAGKMALAKAPSVASMDKSSCCIVATSTQGSVLPAWSAPREAPDGGLFAVRRHLWGSHGNSSFPEFFHNMDYFKYHNMRPPFTYATLIRWAILEAPERQRTLNEIYHWFTRMFAYFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDEFEFRKKRSQRPNKCSNPCP DIP protein Q99JB6 original sequence version: 120 DIP protein Q99JB6 original sequence version: 110 DIP protein Q99JB6 original sequence version: 114 DIP protein Q99JB6 original sequence version: 102 DIP protein Q99JB6 original sequence version: 100 28D5B8E67891840C il2_mouse_gene Interleukin-2 Il2 Il-2 gene gene mouse Mus musculus Mouse re2_probe_il2_promoter ss dna single stranded deoxyribonucleic acid ss DNA ss dna mouse Mus musculus Mouse TAGAAATGGGGACACCACAGGCAAGCTC runx1_mouse Runt-related transcription factor 1 Runx1 Aml1 Cbfa2 Pebp2ab Acute myeloid leukemia 1 protein Core-binding factor subunit alpha-2 Oncogene AML-1 Polyomavirus enhancer-binding protein 2 alpha B subunit SL3-3 enhancer factor 1 alpha B subunit SL3/AKV core-binding factor alpha B subunit protein protein mouse Mus musculus Mouse MRIPVDASTSRRFTPPSTALSPGKMSEALPLGAPDGGPALASKLRSGDRSMVEVLADHPGELVRTDSPNFLCSVLPTHWRCNKTLPIAFKVVALGDVPDGTLVTVMAGNDENYSAELRNATAAMKNQVARFNDLRFVGRSGRGKSFTLTITVFTNPPQVATYHRAIKITVDGPREPRRHRQKLDDQTKPGSLSFSERLSELEQLRRTAMRVSPHHPAPTPNPRASLNHSTAFNPQPQSQMQDARQIQPSPPWSYDQSYQYLGSITSSSVHPATPISPGRASGMTSLSAELSSRLSTAPDLTAFGDPRQFPTLPSISDPRMHYPGAFTYSPPVTSGIGIGMSAMSSASRYHTYLPPPYPGSSQAQAGPFQTGSPSYHLYYGASAGSYQFSMVGGERSPPRILPPCTNASTGAALLNPSLPSQSDVVETEGSHSNSPTNMPPARLEEAVWRPY DIP protein Q03347 original sequence version: 136 DIP protein Q03347 original sequence version: 128 tnr18_mouse_gene Tumor necrosis factor receptor superfamily member 18 Tnfrsf18 Gitr gene gene mouse Mus musculus Mouse ifng_mouse_gene Interferon gamma Ifng gene gene mouse Mus musculus Mouse ifng_human_gene Interferon gamma IFNG gene gene human Homo sapiens Human foxp3_human Forkhead box protein P3 Scurfin FOXP3 IPEX JM2 protein protein human Homo sapiens Human MPNPRPGKPSAPSLALGPSPGASPSWRAAPKASDLLGARGPGGTFQGRDLRGGAHASSSSLNPMPPSQLQLPTLPLVMVAPSGARLGPLPHLQALLQDRPHFMHQLSTVDAHARTPVLQVHPLESPAMISLTPPTTATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPNPSAPRKDSTLSAVPQSSYPLLANGVCKWPGCEKVFEEPEDFLKHCQADHLLDEKGRAQCLLQREMVQSLEQQLVLEKEKLSAMQAHLAGKMALTKASSVASSDKGSCCIVAAGSQGPVVPAWSGPREAPDSLFAVRRHLWGSHGNSTFPEFLHNMDYFKFHNMRPPFTYATLIRWAILEAPEKQRTLNEIYHWFTRMFAFFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDELEFRKKRSQRPSRCSNPTPGP DIP protein Q9BZS1 original sequence version: 139 DIP protein Q9BZS1 original sequence version: 131 91737C3CEA665A15 runx1-il2-1 5 18 unspecified role unspecified role bait bait 16 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 1B Q03347 increases the expression at protein level of ENSMUSG00000027720 The construct "AML1A" decreased the expression of IL2. not added causality from Figs 3c/d/e as Human proteins used in mouse cells. Q99JB6 reduces the expression at protein level of ENSMUSG00000027720 Causality from Figs 1i, 1h, 3h +i runx1-il2-2 2 12 unspecified role unspecified role bait bait 13 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 1B I have not added causality from Figs 1D, 3A as they use a mouse IL2 gene reporter construct in human cells - so I would not know where to add the statement! re1_probe_il2_promoter-runx1-1 6 14 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined c15t,a16g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain CA TG 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction 1C re1_probe_il2_promoter-runx1-2 6 17 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined c16t,a17g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain CA TG 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction 1C-2 re2_probe_il2_promoter-runx1-1 6 10 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined c17t,a18g mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain TG CA 12 unspecified role unspecified role prey prey n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range DNA_binding_domain sufficient to bind sufficient binding region sufficient to bind range range range range human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. direct interaction direct interaction 1C-3 Binding to the Re-2 probe was weaker. foxp3-runx1-1 1 12 unspecified role unspecified role prey prey 22 unspecified role unspecified role bait bait physical association physical association 2A foxp3-runx1-2 3 18 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro 15 unspecified role unspecified role bait bait n_terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) physical association physical association 2B runx1-foxp3-1 3 18 unspecified role unspecified role bait bait n_terminus gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 15 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined in vitro In vitro physical association physical association 2Bi foxp3-runx1-3 7 18 unspecified role unspecified role neutral component neutral component 15 unspecified role unspecified role neutral component neutral component colocalization colocalization 2C foxp3-runx1-5 4 18 unspecified role unspecified role bait bait region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 15 unspecified role unspecified role prey prey n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range physical association physical association 2E, Supp 12 foxp3-runx1-6 4 18 unspecified role unspecified role prey prey n_terminus ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range 15 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain Q99JB6:p.Asp329_Tyr330delinsValHis mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain DY VH Fri Jul 22 11:10:16 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp329val,tyr330his' Wed May 02 18:08:59 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr329-330val_his' Tue Jun 30 16:49:02 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp329_Tyr330delinsValHis' Q99JB6:p.[Asp329_Tyr330delinsValHis;Lys332Leu] mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain DY VH certain certain sequence position certain certain certain sequence position certain K L Fri Jul 22 10:55:17 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'asp329val,tyr330his,lys332leu' Wed May 02 16:03:07 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp_tyr329-330val_his,lys332leu' Tue Jun 30 19:46:51 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Asp329_Tyr330delinsValHis;Lys332Leu]' physical association physical association 2G, 3G foxp3-il2-8 5 15 unspecified role unspecified role bait bait 16 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp 4 foxp3-nfatc2-2 4 15 unspecified role unspecified role bait bait n_terminus flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged n-term range n-terminal range n-term range n-term range n-terminal range n-term range 8 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined undefined mutation mutation mutation undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined Wed Jul 06 16:38:14 BST 2016 Sequence change details about this feature cannot be ascertained or do not fit with the current version of the referenced protein, so they have been deleted as a result of our quality control procedures. The original label was 'serXala' looked at 26/9/17 and "no-mutation export" annotation removed -otherwise not altered-Mgt physical association physical association Supp 6 From Supp Ref 1 + 2,, HA-tagged NFAT-CA is a constitutive active form of murine NFAT1 isoform C with twelve serine to alanine mutations. This mutant is probably the (ST2+5+8) mutant described. if you think I should add the mutations for nfatc2 - please send back-they can be seen in fig 2 pmid: 11030334 -Okamura -2000. runx1-il2ra_mouse_gene-1 5 18 unspecified role unspecified role bait bait 11 unspecified role unspecified role prey prey intron1_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 8 runx1-il2ra_mouse_gene-2 5 18 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 8-1 Q99JB6 increases the expression at protein level of ENSMUSG00000026011 runx1-ctla4-1 5 18 unspecified role unspecified role bait bait 19 unspecified role unspecified role prey prey intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 8-2 foxp3-tnfrsf18-1 5 15 unspecified role unspecified role bait bait 19 unspecified role unspecified role prey prey intronic_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 9 Q99JB6 increases the expression at protein level of ENSMUSG00000041954 causality from fig 4A foxp3-il2ra_mouse_gene-3 5 15 unspecified role unspecified role bait bait 11 unspecified role unspecified role prey prey intron1_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 9 Q99JB6 increases the expression at protein level of ENSMUSG00000026770 causality from 4A runx1-ifng-1 5 18 unspecified role unspecified role bait bait 20 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp Fig 11D runx1-il2_human_gene-1 2 12 unspecified role unspecified role bait bait 21 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association Supp 11D