IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ FOXP3 controls regulatory T cell function through cooperation with NFAT. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell (0092-8674) 2006 imex curation Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu 25-OCT-2006: Contacted by JYOTI. Only protein-protein interactions mouse-t-cell Mouse T cell t-cell Peripheral blood T-lymphocytes ch-ip chromatin immunoprecipitation assay ch-ip q-pcr quantitative pcr q-pcr Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease Mouse T cells; these were either "natural" TReg cells (CD4+ CD25+) or retrovirally transduced with (human) FOXP3. Cells were stimulated by PMA/Ionomycin. linchen@usc.edu Accepted 2006-SEP-26 by DAVET. 25-OCT-2006: Contacted by JYOTI. Cell (0092-8674) 2006 Only protein-protein interactions imex curation FOXP3 controls regulatory T cell function through cooperation with NFAT. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell (0092-8674) 2006 imex curation Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu 25-OCT-2006: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Accepted 2006-SEP-26 by DAVET. 25-OCT-2006: Contacted by JYOTI. Cell (0092-8674) 2006 Only protein-protein interactions imex curation FOXP3 controls regulatory T cell function through cooperation with NFAT. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell (0092-8674) 2006 imex curation Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu 25-OCT-2006: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro crosslink cross-linking study crosslink predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Accepted 2006-SEP-26 by DAVET. 25-OCT-2006: Contacted by JYOTI. Cell (0092-8674) 2006 Only protein-protein interactions imex curation FOXP3 controls regulatory T cell function through cooperation with NFAT. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell (0092-8674) 2006 imex curation Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu 25-OCT-2006: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Wu Y., Borde M., Heissmeyer V., Feuerer M., Lapan AD., Stroud JC., Bates DL., Guo L., Han A., Ziegler SF., Mathis D., Benoist C., Chen L., Rao A. IBD - Inflammatory bowel disease linchen@usc.edu Accepted 2006-SEP-26 by DAVET. 25-OCT-2006: Contacted by JYOTI. Cell (0092-8674) 2006 Only protein-protein interactions imex curation nfac2_human Nuclear factor of activated T-cells, cytoplasmic 2 T-cell transcription factor NFAT1 NFAT pre-existing subunit NFATC2 NFAT1 NFATP protein protein human Homo sapiens Human MNAPERQPQPDGGDAPGHEPGGSPQDELDFSILFDYEYLNPNEEEPNAHKVASPPSGPAYPDDVLDYGLKPYSPLASLSGEPPGRFGEPDRVGPQKFLSAAKPAGASGLSPRIEITPSHELIQAVGPLRMRDAGLLVEQPPLAGVAASPRFTLPVPGFEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNGGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVALPPGASPQRSRSPSPQPSSHVAPQDHGSPAGYPPVAGSAVIMDALNSLATDSPCGIPPKMWKTSPDPSPVSAAPSKAGLPRHIYPAVEFLGPCEQGERRNSAPESILLVPPTWPKPLVPAIPICSIPVTASLPPLEWPLSSQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHIPESSGRIVSLQTASNPIECSQRSAHELPMVERQDTDSCLVYGGQQMILTGQNFTSESKVVFTEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRTPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPTDEYDPTLICSPTHGGLGSQPYYPQHPMVAESPSCLVATMAPCQQFRTGLSSPDARYQQQNPAAVLYQRSKSLSPSLLGYQQPALMAAPLSLADAHRSVLVHAGSQGQSSALLHPSPTNQQASPVIHYSPTNQQLRCGSHQEFQHIMYCENFAPGTTRPGPPPVSQGQRLSPGSYPTVIQQQNATSQRAAKNGPPVSDQKEVLPAGVTIKQEQNLDQTYLDDVNEIIRKEFSGPPARNQT DIP protein Q13469 original sequence version: 99 DIP protein Q13469 original sequence version: 100 DIP protein Q13469 original sequence version: 167 8DAE86855CCB58D3 foxp3_mouse Forkhead box protein P3 Foxp3 Scurfin protein protein mouse Mus musculus Mouse MPNPRPAKPMAPSLALGPSPGVLPSWKTAPKGSELLGTRGSGGPFQGRDLRSGAHTSSSLNPLPPSQLQLPTVPLVMVAPSGARLGPSPHLQALLQDRPHFMHQLSTVDAHAQTPVLQVRPLDNPAMISLPPPSAATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPRSGTPRKDSNLLAAPQGSYPLLANGVCKWPGCEKVFEEPEEFLKHCQADHLLDEKGKAQCLLQREVVQSLEQQLELEKEKLGAMQAHLAGKMALAKAPSVASMDKSSCCIVATSTQGSVLPAWSAPREAPDGGLFAVRRHLWGSHGNSSFPEFFHNMDYFKYHNMRPPFTYATLIRWAILEAPERQRTLNEIYHWFTRMFAYFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDEFEFRKKRSQRPNKCSNPCP DIP protein Q99JB6 original sequence version: 120 DIP protein Q99JB6 original sequence version: 110 DIP protein Q99JB6 original sequence version: 114 DIP protein Q99JB6 original sequence version: 102 DIP protein Q99JB6 original sequence version: 100 28D5B8E67891840C foxp2_human Forkhead box protein P2 CAG repeat protein 44 Trinucleotide repeat-containing gene 10 protein FOXP2 CAGH44 TNRC10 protein protein human Homo sapiens Human MMQESATETISNSSMNQNGMSTLSSQLDAGSRDGRSSGDTSSEVSTVELLHLQQQQALQAARQLLLQQQTSGLKSPKSSDKQRPLQVPVSVAMMTPQVITPQQMQQILQQQVLSPQQLQALLQQQQAVMLQQQQLQEFYKKQQEQLHLQLLQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQQHPGKQAKEQQQQQQQQQQLAAQQLVFQQQLLQMQQLQQQQHLLSLQRQGLISIPPGQAALPVQSLPQAGLSPAEIQQLWKEVTGVHSMEDNGIKHGGLDLTTNNSSSTTSSNTSKASPPITHHSIVNGQSSVLSARRDSSSHEETGASHTLYGHGVCKWPGCESICEDFGQFLKHLNNEHALDDRSTAQCRVQMQVVQQLEIQLSKERERLQAMMTHLHMRPSEPKPSPKPLNLVSSVTMSKNMLETSPQSLPQTPTTPTAPVTPITQGPSVITPASVPNVGAIRRRHSDKYNIPMSSEIAPNYEFYKNADVRPPFTYATLIRQAIMESSDRQLTLNEIYSWFTRTFAYFRRNAATWKNAVRHNLSLHKCFVRVENVKGAVWTVDEVEYQKRRSQKITGSPTLVKNIPTSLGYGAALNASLQAALAESSLPLLSNPGLINNASSGLLQAVHEDLNGSLDHIDSNGNSSPGCSPQPHIHSIHVKEEPVIAEDEDCPMSLVTTANHSPELEDDREIEEEPLSEDLE DIP protein O15409 original sequence version: 60 DIP protein O15409 original sequence version: 100 4F9FBDB6D90516E0 il2_mouse_gene Interleukin-2 Il2 Il-2 gene gene mouse Mus musculus Mouse ctla4_mouse_gene Ctla4 gene gene mouse Mus musculus Mouse foxp3_human Forkhead box protein P3 Scurfin FOXP3 IPEX JM2 protein protein human Homo sapiens Human MPNPRPGKPSAPSLALGPSPGASPSWRAAPKASDLLGARGPGGTFQGRDLRGGAHASSSSLNPMPPSQLQLPTLPLVMVAPSGARLGPLPHLQALLQDRPHFMHQLSTVDAHARTPVLQVHPLESPAMISLTPPTTATGVFSLKARPGLPPGINVASLEWVSREPALLCTFPNPSAPRKDSTLSAVPQSSYPLLANGVCKWPGCEKVFEEPEDFLKHCQADHLLDEKGRAQCLLQREMVQSLEQQLVLEKEKLSAMQAHLAGKMALTKASSVASSDKGSCCIVAAGSQGPVVPAWSGPREAPDSLFAVRRHLWGSHGNSTFPEFLHNMDYFKFHNMRPPFTYATLIRWAILEAPEKQRTLNEIYHWFTRMFAFFRNHPATWKNAIRHNLSLHKCFVRVESEKGAVWTVDELEFRKKRSQRPSRCSNPTPGP DIP protein Q9BZS1 original sequence version: 139 DIP protein Q9BZS1 original sequence version: 131 91737C3CEA665A15 foxp1_human Forkhead box protein P1 FOXP1 Mac-1-regulated forkhead HSPC215 protein protein human Homo sapiens Human MMQESGTETKSNGSAIQNGSGGSNHLLECGGLREGRSNGETPAVDIGAADLAHAQQQQQQALQVARQLLLQQQQQQQVSGLKSPKRNDKQPALQVPVSVAMMTPQVITPQQMQQILQQQVLSPQQLQVLLQQQQALMLQQQQLQEFYKKQQEQLQLQLLQQQHAGKQPKEQQQVATQQLAFQQQLLQMQQLQQQHLLSLQRQGLLTIQPGQPALPLQPLAQGMIPTELQQLWKEVTSAHTAEETTGNNHSSLDLTTTCVSSSAPSKTSLIMNPHASTNGQLSVHTPKRESLSHEEHPHSHPLYGHGVCKWPGCEAVCEDFQSFLKHLNSEHALDDRSTAQCRVQMQVVQQLELQLAKDKERLQAMMTHLHVKSTEPKAAPQPLNLVSSVTLSKSASEASPQSLPHTPTTPTAPLTPVTQGPSVITTTSMHTVGPIRRRYSDKYNVPISSADIAQNQEFYKNAEVRPPFTYASLIRQAILESPEKQLTLNEIYNWFTRMFAYFRRNAATWKNAVRHNLSLHKCFVRVENVKGAVWTVDEVEFQKRRPQKISGNPSLIKNMQSSHAYCTPLNAALQASMAENSIPLYTTASMGNPTLGNLASAIREELNGAMEHTNSNESDSSPGRSPMQAVHPVHVKEEPLDPEEAEGPLSLVTTANHSPDFDHDRDYEDEPVNEDME DIP protein Q9H334 original sequence version: 89 AEE92D47BB20964B arre2_element_mouse_il2_promoter dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid in vitro In vitro CAAAGAGGAAAATTTGTTTCATACAGAAGG 21E6FBC49C3BECCA il2ra_mouse_gene Interleukin-2 receptor subunit alpha gene gene gene mouse Mus musculus Mouse nfac2_mouse Nuclear factor of activated T-cells, cytoplasmic 2 T-cell transcription factor NFAT1 NFAT pre-existing subunit Nfatc2 Nfat1 Nfatp protein protein mouse Mus musculus Mouse MDVPEPQPDPDGGDGPGHEPGGSPQDELDFSILFDYDYLNPIEEEPIAHKAISSPSGLAYPDDVLDYGLKPCNPLASLSGEPPGRFGEPDSIGFQNFLSPVKPAGASGPSPRIEITPSHELMQAGGALRGRDAGLSPEQPALALAGVAASPRFTLPVPGYEGYREPLCLSPASSGSSASFISDTFSPYTSPCVSPNNAGPDDLCPQFQNIPAHYSPRTSPIMSPRTSLAEDSCLGRHSPVPRPASRSSSPGAKRRHSCAEALVAPLPAASPQRSRSPSPQPSPHVALQDDSIPAGYPPTAGSAVLMDALNTLATDSPCGIPSKIWKTSPDPTPVSTAPSKAGLARHIYPTVEFLGPCEQEERRNSAPESILLVPPTWPKQLVPAIPICSIPVTASLPPLEWPLSNQSGSYELRIEVQPKPHHRAHYETEGSRGAVKAPTGGHPVVQLHGYMENKPLGLQIFIGTADERILKPHAFYQVHRITGKTVTTTSYEKIVGNTKVLEIPLEPKNNMRATIDCAGILKLRNADIELRKGETDIGRKNTRVRLVFRVHVPEPSGRIVSLQAASNPIECSQRSAHELPMVERQDMDSCLVYGGQQMILTGQNFTAESKVVFMEKTTDGQQIWEMEATVDKDKSQPNMLFVEIPEYRNKHIRVPVKVNFYVINGKRKRSQPQHFTYHPVPAIKTEPSDEYEPSLICSPAHGGLGSQPYYPQHPMLAESPSCLVATMAPCQQFRSGLSSPDARYQQQSPAAALYQRSKSLSPGLLGYQQPSLLAAPLGLADAHRSVLVHAGSQGQGQGSTLPHTSSASQQASPVIHYSPTNQQLRGGGHQEFQHIMYCENFGPSSARPGPPPINQGQRLSPGAYPTVIQQQTAPSQRAAKNGPSDQKEALPTGVTVKQEQNLDQTYLDDVNEIIRKEFSGPPSRNQT F21E7BABE7DBB40F foxp2-nfatc2 2 12 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain in vitro In vitro 7 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 5 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain direct interaction direct interaction table S1 30.0-2.70 A 24.5% - 28.6% foxp3-nfatc2-1 4 10 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) 12 unspecified role unspecified role neutral component neutral component in vitro In vitro 5 unspecified role unspecified role neutral component neutral component dbd sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) association association 1C Cooperative binding observed. foxp2-nfatc2-1 4 5 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 12 unspecified role unspecified role neutral component neutral component in vitro In vitro 7 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) association association S1E foxp2-nfatc2-2 3 12 unspecified role unspecified role neutral component neutral component in vitro In vitro 7 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) physical association physical association S1F foxp1-nfatc2-1 4 5 unspecified role unspecified role neutral component neutral component rel homology domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 11 unspecified role unspecified role neutral component neutral component forkhead domain sufficient to bind sufficient binding region sufficient to bind range range range range ecoli Escherichia coli (strain K12) 12 unspecified role unspecified role neutral component neutral component in vitro In vitro association association S1D foxp3-il2-1 1 8 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A foxp3-il2-2 1 6 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A-2 foxp3-ctla4-1 1 9 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A-3 this gene (ctla4) short label + XRefs had to be altered as the Uniprot reviewed entry has no Ensembl XRef- so an entry had been created with a Trembl entry in the short label- so have altered the "gene". foxp3-ctla4-2 1 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A-4 foxp3-il2ra_mouse_gene-1 1 13 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 10 unspecified role unspecified role bait bait region myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A-5 foxp3-il2ra_mouse_gene-2 1 6 unspecified role unspecified role bait bait 13 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 6A-6 nfatc2-il2-2 1 8 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 14 unspecified role unspecified role bait bait association association 6 B/C Q9BZS1 increased binding of Q60591 to ENSMUSG00000027720 CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000027720 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. nfatc2-ctla4-1 1 9 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 14 unspecified role unspecified role bait bait association association 6 B/C Q9BZS1 increased binding of Q60591 to ENSMUSG00000026011 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000026011 nfatc2-il2ra_mouse_gene-1 1 13 unspecified role unspecified role prey prey promoter_region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 14 unspecified role unspecified role bait bait association association 6 B/C Q9BZS1 increases binding of Q60591 to ENSMUSG00000026770 Cyclosporin A (CHEBI:4031) -an immunosuppressant, inhibiting the calcineurin induced dephosphorylation of NFATc, resulting in reduced IL2 production and suppression of T cell activation. CHEBI:4031 decreases binding of Q60591 to ENSMUSG00000026770