IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Systemic lupus erythematosus serum IgG increases CREM binding to the IL-2 promoter and suppresses IL-2 production through CaMKIV. Systemic lupus erythematosus serum IgG increases CREM binding to the IL-2 promoter and suppresses IL-2 production through CaMKIV. J. Clin. Invest. (0021-9738) 2005 imex curation Juang Y.T., Wang Y., Solomou E.E., Li Y., Mawrin C., Tenbrock K., Kyttaris V.C., Tsokos G.C. IBD - Inflammatory bowel disease Fig. 1C shows competition between CREM and the CREM epitope peptide (used for immunisation) for the anti-CREM antibody; the peptide blocks the supershift by preventing binding of the antibody to CREM; should this be captured as a competitive interaction? The human CaMKIV and rat CaMKII expression constructs are described in PMID:8702940 and PMID:8253736, respectively. The human IL2 promoter constructs are described in PMID:11238674 and PMID:1737937. IL2 promoter wild type and mutant probes are described in PMID:11238674 and PMID:11313407. gtsokos@usuhs.mil 22-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa supershift electrophoretic mobility supershift assay emsa supershift autoradiography autoradiography Juang Y.T., Wang Y., Solomou E.E., Li Y., Mawrin C., Tenbrock K., Kyttaris V.C., Tsokos G.C. IBD - Inflammatory bowel disease Fig. 1C shows competition between CREM and the CREM epitope peptide (used for immunisation) for the anti-CREM antibody; the peptide blocks the supershift by preventing binding of the antibody to CREM; should this be captured as a competitive interaction? The human CaMKIV and rat CaMKII expression constructs are described in PMID:8702940 and PMID:8253736, respectively. The human IL2 promoter constructs are described in PMID:11238674 and PMID:1737937. IL2 promoter wild type and mutant probes are described in PMID:11238674 and PMID:11313407. gtsokos@usuhs.mil Accepted 2015-JAN-14 by MGT J. Clin. Invest. (0021-9738) 2005 Only protein-protein interactions imex curation crem_human cAMP-responsive element modulator CREM Inducible cAMP early repressor protein protein human Homo sapiens Human MTMETVESQHDGSITASLTESKSAHVQTQTGQNSIPALAQVSVAGSGTRRGSPAVTLVQLPSGQTIHVQGVIQTPQPWVIQSSEIHTVQVAAIAETDESAESEGVIDSHKRREILSRRPSYRKILNELSSDVPGVPKIEEERSEEEGTPPSIATMAVPTSIYQTSTGQYIAIAQGGTIQISNPGSDGVQGLQALTMTNSGAPPPGATIVQYAAQSADGTQQFFVPGSQVVVQDEETELAPSHMAAATGDMPTYQIRAPTAALPQGVVMAASPGSLHSPQQLAEEATRKRELRLMKNREAAKECRRRKKEYVKCLESRVAVLEVQNKKLIEELETLKDICSPKTDY 4DDEE62904CDD0E6 creb1_human Cyclic AMP-responsive element-binding protein 1 CREB1 protein protein human Homo sapiens Human MTMESGAENQQSGDAAVTEAENQQMTVQAQPQIATLAQVSMPAAHATSSAPTVTLVQLPNGQTVQVHGVIQAAQPSVIQSPQVQTVQISTIAESEDSQESVDSVTDSQKRREILSRRPSYRKILNDLSSDAPGVPRIEEEKSEEETSAPAITTVTVPTPIYQTSSGQYIAITQGGAIQLANNGTDGVQGLQTLTMTNAAATQPGTTILQYAQTTDGQQILVPSNQVVVQAASGDVQTYQIRTAPTSTIAPGVVMASSPALPTQPAEEAARKREVRLMKNREAARECRRKKKEYVKCLENRVAVLENQNKTLIEELKALKDLYCHKSD DIP protein P16220 original sequence version: 169 DIP protein P16220 original sequence version: 158 F5BA8200EE5184B7 il2_human_crem-site_dna-probe Human IL2 gene promoter CREM-binding site DNA probe dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human CATCCATTCAGTCAGTCTTTGGGGGT il2-crem 1 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) 2 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia physical association physical association Fig. 1b, 1c il2-crem-1 1 2 unspecified role unspecified role prey prey human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2b T cells were taken from an SLE (Systemic lupus erythematosus) patient. Q16566 increases binding of Q03060 to ENSG00000109471 in SLE T cells Q16566 indirectly decreases expression at RNA level of ENSG00000109471 in SLE T cells il2-crem-2 1 2 competitor competitor competitor prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 2 unspecified role unspecified role prey prey human-jurkat Homo sapiens jurkat Human T cell leukemia 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) association association Fig. 1c il2-creb1 1 3 unspecified role unspecified role prey prey human-t-cell Homo sapiens t-cell Peripheral blood T-lymphocytes 4 unspecified role unspecified role bait bait region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chemical synthesis Chemical synthesis (Chemical synthesis) physical association physical association Fig. 2b T cells were taken from an SLE (Systemic lupus erythematosus) patient.