IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The SARS-unique domain (SUD) of SARS coronavirus contains two macrodomains that bind G-quadruplexes. The SARS-unique domain (SUD) of SARS coronavirus contains two macrodomains that bind G-quadruplexes. PLoS pathogens 2009 imex curation Tan J., Vonrhein C., Smart OS., Bricogne G., Bollati M., Kusov Y., Hansen G., Mesters JR., Schmidt CL., Hilgenfeld R. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus hilgenfeld@biochem.uni-luebeck.de 28-Sep-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Tan J., Vonrhein C., Smart OS., Bricogne G., Bollati M., Kusov Y., Hansen G., Mesters JR., Schmidt CL., Hilgenfeld R. Virus - Publications including interactions involving viral proteins hilgenfeld@biochem.uni-luebeck.de Accepted 2020-AUG-17 AT 08:13 BST AT 08:13 BST by ORCHARD PLoS pathogens 2009 Only protein-protein interactions imex curation imex curation The SARS-unique domain (SUD) of SARS coronavirus contains two macrodomains that bind G-quadruplexes. The SARS-unique domain (SUD) of SARS coronavirus contains two macrodomains that bind G-quadruplexes. PLoS pathogens 2009 imex curation Tan J., Vonrhein C., Smart OS., Bricogne G., Bollati M., Kusov Y., Hansen G., Mesters JR., Schmidt CL., Hilgenfeld R. Virus - Publications including interactions involving viral proteins Coronavirus - Interactions investigated in the context of Coronavirus hilgenfeld@biochem.uni-luebeck.de 28-Sep-2020: Contacted by IntAct-Help. Only protein-protein interactions imex curation in vitro In vitro comigration in gel comigration in gel electrophoresis comigration in gel weight by staining molecular weight estimation by staining weight by staining Tan J., Vonrhein C., Smart OS., Bricogne G., Bollati M., Kusov Y., Hansen G., Mesters JR., Schmidt CL., Hilgenfeld R. Virus - Publications including interactions involving viral proteins The method is based on the measurement of the migration distance of a macromolecular complex in rapid dynamic equilibrium as function of increasing DNA G-quadruplex formation in the presence of K+ ions concentration in a surrounding zone. Origin of bcl2 gene was found to be human by the given 2F8U structure hilgenfeld@biochem.uni-luebeck.de Accepted 2020-AUG-17 AT 08:13 BST AT 08:13 BST by ORCHARD PLoS pathogens 2009 Only protein-protein interactions imex curation imex curation elastin_3'utr_chicken Chicken elastin mRNA 3'UTR rna ribonucleic acid RNA rna chick Gallus gallus (Chicken) Chicken UGGGGGGAGGGAGGGAGGGA p0c6x7-pro_0000037311 Papain-like protease nsp3 rep ORF1ab polyprotein 1a-1b protein protein sars-cov Human SARS coronavirus SARS-CoV Severe acute respiratory syndrome coronavirus APIKGVTFGEDTVWEVQGYKNVRITFELDERVDKVLNEKCSVYTVESGTEVTEFACVVAEAVVKTLQPVSDLLTNMGIDLDEWSVATFYLFDDAGEENFSSRMYCSFYPPDEEEEDDAECEEEEIDETCEHEYGTEDDYQGLPLEFGASAETVRVEEEEEEDWLDDTTEQSEIEPEPEPTPEEPVNQFTGYLKLTDNVAIKCVDIVKEAQSANPMVIVNAANIHLKHGGGVAGALNKATNGAMQKESDDYIKLNGPLTVGGSCLLSGHNLAKKCLHVVGPNLNAGEDIQLLKAAYENFNSQDILLAPLLSAGIFGAKPLQSLQVCVQTVRTQVYIAVNDKALYEQVVMDYLDNLKPRVEAPKQEEPPNTEDSKTEEKSVVQKPVDVKPKIKACIDEVTTTLEETKFLTNKLLLFADINGKLYHDSQNMLRGEDMSFLEKDAPYMVGDVITSGDITCVVIPSKKAGGTTEMLSRALKKVPVDEYITTYPGQGCAGYTLEEAKTALKKCKSAFYVLPSEAPNAKEEILGTVSWNLREMLAHAEETRKLMPICMDVRAIMATIQRKYKGIKIQEGIVDYGVRFFFYTSKEPVASIITKLNSLNEPLVTMPIGYVTHGFNLEEAARCMRSLKAPAVVSVSSPDAVTTYNGYLTSSSKTSEEHFVETVSLAGSYRDWSYSGQRTELGVEFLKRGDKIVYHTLESPVEFHLDGEVLSLDKLKSLLSLREVKTIKVFTTVDNTNLHTQLVDMSMTYGQQFGPTYLDGADVTKIKPHVNHEGKTFFVLPSDDTLRSEAFEYYHTLDESFLGRYMSALNHTKKWKFPQVGGLTSIKWADNNCYLSSVLLALQQLEVKFNAPALQEAYYRARAGDAANFCALILAYSNKTVGELGDVRETMTHLLQHANLESAKRVLNVVCKHCGQKTTTLTGVEAVMYMGTLSYDNLKTGVSIPCVCGRDATQYLVQQESSFVMMSAPPAEYKLQQGTFLCANEYTGNYQCGHYTHITAKETLYRIDGAHLTKMSEYKGPVTDVFYKETSYTTTIKPVSYKLDGVTYTEIEPKLDGYYKKDNAYYTEQPIDLVPTQPLPNASFDNFKLTCSNTKFADDLNQMTGFTKPASRELSVTFFPDLNGDVVAIDYRHYSASFKKGAKLLHKPIVWHINQATTKTTFKPNTWCLRCLWSTKPVDTSNSFEVLAVEDTQGMDNLACESQQPTSEEVVENPTIQKEVIECDVKTTEVVGNVILKPSDEGVKVTQELGHEDLMAAYVENTSITIKKPNELSLALGLKTIATHGIAAINSVPWSKILAYVKPFLGQAAITTSNCAKRLAQRVFNNYMPYVFTLLFQLCTFTKSTNSRIRASLPTTIAKNSVKSVAKLCLDAGINYVKSPKFSKLFTIAMWLLLLSICLGSLICVTAAFGVLLSNFGAPSYCNGVRELYLNSSNVTTMDFCEGSFPCSICLSGLDSLDSYPALETIQVTISSYKLDLTILGLAAEWVLAYMLFTKFFYLLGLSAIMQVFFGYFASHFISNSWLMWFIISIVQMAPVSAMVRMYIFFASFYYIWKSYVHIMDGCTSSTCMMCYKRNRATRVECTTIVNGMKRSFYVYANGGRGFCKTHNWNCLNCDTFCTGSTFISDEVARDLSLQFKRPINPTDQSSYIVDSVAVKNGALHLYFDKAGQKTYERHPLSHFVNLDNLRANNTKGSLPINVIVFDGKSKCDESASKSASVYYSQLMCQPILLLDQALVSDVGDSTEVSVKMFDAYVDTFSATFSVPMEKLKALVATAHSELAKGVALDGVLSTFVSAARQGVVDTDVDTKDVIECLKLSHHSDLEVTGDSCNNFMLTYNKVENMTPRDLGACIDCNARHINAQVAKSHNVSLIWNVKDYMSLSEQLRKQIRSAAKKNNIPFRLTCATTRQVVNVITTKISLKGG 819 2740 BBB1A6190358ADDE bcl2_human_gene Apoptosis regulator Bcl-2 BCL2 gene gene human Homo sapiens Human bcl2_promoter_reverse_complement human_bcl2_promoter_reverse_complement rna ribonucleic acid RNA rna human Homo sapiens Human CCGCCCAATTCCTCCCGCGCCC rep-104 1 4 unspecified role unspecified role neutral component neutral component purified purified SUD core domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Table 1 Rwork: 0.211 Rfree: 0.268 2.22Å bcl2-rep-1 2 4 unspecified role unspecified role neutral component neutral component purified purified P0C6X7-PRO_0000037311:p.Lys505_Lys506delinsAlaAla mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain KK AA Wed Sep 16 11:15:58 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys505_Lys506delinsAlaAla' SUD core domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range P0C6X7-PRO_0000037311:p.Lys476_Lys477delinsAlaAla mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain KK AA Mon Sep 21 12:16:14 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys476_Lys477delinsAlaAla' P0C6X7-PRO_0000037311:p.[Lys563Ala;Lys565Ala;Lys568Ala] mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain K A Wed Sep 16 10:00:31 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys563Ala;Lys565Ala;Lys568Ala]' P0C6X7-PRO_0000037311:p.[Lys565Ala;Lys568Ala;Glu571Ala] mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain K A certain certain sequence position certain certain certain sequence position certain E A Wed Sep 16 11:10:02 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Lys565Ala;Lys568Ala;Glu571Ala]' ecoli Escherichia coli (strain K12) 5 unspecified role unspecified role neutral component neutral component purified purified promoter region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined chr18:63317396-63317409 GGGCGCGGGAGGAATTGGGCGG direct interaction direct interaction Fig. 4b, Fig 5 I could get BLAT results only in NCBI, which mapped to NG_009361.1 range 4245-4258. Genomic coordinates were obtained by BLATing NG_009361.1 sequence in UCSC browser KCl (CHEBI:32588) bcl2_promoter_reverse_complement-rep-1 2 4 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range SUD core domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 6 unspecified role unspecified role neutral component neutral component purified purified direct interaction direct interaction Fig. 4c SUB core domain bound with reverse-complementary sequence with low affinity and independent of K+ ions eln-rep-1 2 3 unspecified role unspecified role neutral component neutral component purified purified chr19(+): 962388-962407 4 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range SUD core domain sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 4c