bhf-ucl Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column weight by comassie molecular weight estimation by coomasie staining weight by comassie Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins The actual sequence used for pre-hsa-mir-200a is AUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGU, which is shorter but capable of forming both of the required mature miRNAs hsa-miR-200a-5p (mirBase accession ID MIMAT0001620) and hsa-miR-200a-3p (mirBase accession ID MIMAT0000682). doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins The actual sequence used for pre-let-7a is UGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUACC, which is shorter but capable of forming both of the required matrure miRNA strands: hsa-let-7a-5p (mirBase ID MIMAT0000062), and hsa-let-7a-3p (mirBase ID MIMAT0004481). doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins The actual sequence used for re-miR-34c is 5-AGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGG-3, which is shorter but capable of forming the required mature miRNAs hsa-miR-34c-5p (mirBase ID MIMAT0000686) and hsa-miR-34c-3p (mirBase ID MIMAT0004677). doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. Mock publication and experiment for abstract interactions that are not interaction evidences. Mock publication and experiment for abstract interactions that are not interaction evidences. unspecified method Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Differential roles of human Dicer-binding proteins TRBP and PACT in small RNA processing. Nucleic acids research 2013 imex curation Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins doudna@berkeley.edu 04-Aug-2016: Contacted by IntAct-Help. Only protein-protein interactions in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Lee HY., Zhou K., Smith AM., Noland CL., Doudna JA. Cardiac - Interactions involving cardiac related proteins The tags on dsRNA W1 are as follows: 5prime-Biotin-CGGUCUCGGUAAUCCCGAAUUACCGUUGCCCAAGGCCAUU-3 and 5prime-P32-UGGCCUUGGGCAACGGUAAUUCGGGAUUACCGAGACCG-3. The tags on dsRNA W2 are as follows: dsRNA W2, 5prime-Biotin-UUACCGUUGCCCAAGGCCAUUCGGGAUUACCGAGACCG-3, and 5prime-P32-CGGUCUCGGUAAUCCCGAAUGGCCUUGGGCAACGGUAAUU-3. doudna@berkeley.edu Accepted 2016-JUL-11 AT 11:39 BST AT 11:39 BST by ORCHARD Nucleic acids research 2013 imex curation oooh that is exciting! it did not occur to me to put the complexes themselves! (I have already slapped myself on the wrist!). I replaced the Dicer-Ago-TRBP2 with the RISC-loading complex EBI-10816154. I will create the Dicer-Ago-PACT. ago2_human Protein argonaute-2 AGO2 Argonaute RISC catalytic component 2 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer protein protein human Homo sapiens Human MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA DIP protein Q9UKV8 original sequence version: 1(def) DIP protein Q9UKV8 original sequence version: 44 DIP protein Q9UKV8 original sequence version: 60 DIP protein Q9UKV8 original sequence version: 62 DIP protein Q9UKV8 original sequence version: 89 DIP protein Q9UKV8 original sequence version: 85 DIP protein Q9UKV8 original sequence version: 87 DIP protein Q9UKV8 original sequence version: 99 DIP protein Q9UKV8 original sequence version: 117 DIP protein Q9UKV8-1 original sequence version: 117 DIP protein Q9UKV8 original sequence version: 145 DIP protein Q9UKV8 original sequence version: 108 5C8552C43FC81345 pre-let-7a-1 Human MiRNA-pre-hsa-let-7a-1 ds rna ds rna double stranded ribonucleic acid human Homo sapiens Human UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA 577F8A4C0C754DAA pre-hsa-mir-200a hsa-pre-mir-200a ds rna ds rna double stranded ribonucleic acid human Homo sapiens Human CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACUGUCUGGUAACGAUGUUCAAAGGUGACCCGC dicer_human Endoribonuclease Dicer DICER1 DICER HERNA KIAA0928 Helicase with RNase motif protein protein human Homo sapiens Human MKSPALQPLSMAGLQLMTPASSPMGPFFGLPWQQEAIHDNIYTPRKYQVELLEAALDHNTIVCLNTGSGKTFIAVLLTKELSYQIRGDFSRNGKRTVFLVNSANQVAQQVSAVRTHSDLKVGEYSNLEVNASWTKERWNQEFTKHQVLIMTCYVALNVLKNGYLSLSDINLLVFDECHLAILDHPYREIMKLCENCPSCPRILGLTASILNGKCDPEELEEKIQKLEKILKSNAETATDLVVLDRYTSQPCEIVVDCGPFTDRSGLYERLLMELEEALNFINDCNISVHSKERDSTLISKQILSDCRAVLVVLGPWCADKVAGMMVRELQKYIKHEQEELHRKFLLFTDTFLRKIHALCEEHFSPASLDLKFVTPKVIKLLEILRKYKPYERQQFESVEWYNNRNQDNYVSWSDSEDDDEDEEIEEKEKPETNFPSPFTNILCGIIFVERRYTAVVLNRLIKEAGKQDPELAYISSNFITGHGIGKNQPRNKQMEAEFRKQEEVLRKFRAHETNLLIATSIVEEGVDIPKCNLVVRFDLPTEYRSYVQSKGRARAPISNYIMLADTDKIKSFEEDLKTYKAIEKILRNKCSKSVDTGETDIDPVMDDDDVFPPYVLRPDDGGPRVTINTAIGHINRYCARLPSDPFTHLAPKCRTRELPDGTFYSTLYLPINSPLRASIVGPPMSCVRLAERVVALICCEKLHKIGELDDHLMPVGKETVKYEEELDLHDEEETSVPGRPGSTKRRQCYPKAIPECLRDSYPRPDQPCYLYVIGMVLTTPLPDELNFRRRKLYPPEDTTRCFGILTAKPIPQIPHFPVYTRSGEVTISIELKKSGFMLSLQMLELITRLHQYIFSHILRLEKPALEFKPTDADSAYCVLPLNVVNDSSTLDIDFKFMEDIEKSEARIGIPSTKYTKETPFVFKLEDYQDAVIIPRYRNFDQPHRFYVADVYTDLTPLSKFPSPEYETFAEYYKTKYNLDLTNLNQPLLDVDHTSSRLNLLTPRHLNQKGKALPLSSAEKRKAKWESLQNKQILVPELCAIHPIPASLWRKAVCLPSILYRLHCLLTAEELRAQTASDAGVGVRSLPADFRYPNLDFGWKKSIDSKSFISISNSSSAENDNYCKHSTIVPENAAHQGANRTSSLENHDQMSVNCRTLLSESPGKLHVEVSADLTAINGLSYNQNLANGSYDLANRDFCQGNQLNYYKQEIPVQPTTSYSIQNLYSYENQPQPSDECTLLSNKYLDGNANKSTSDGSPVMAVMPGTTDTIQVLKGRMDSEQSPSIGYSSRTLGPNPGLILQALTLSNASDGFNLERLEMLGDSFLKHAITTYLFCTYPDAHEGRLSYMRSKKVSNCNLYRLGKKKGLPSRMVVSIFDPPVNWLPPGYVVNQDKSNTDKWEKDEMTKDCMLANGKLDEDYEEEDEEEESLMWRAPKEEADYEDDFLEYDQEHIRFIDNMLMGSGAFVKKISLSPFSTTDSAYEWKMPKKSSLGSMPFSSDFEDFDYSSWDAMCYLDPSKAVEEDDFVVGFWNPSEENCGVDTGKQSISYDLHTEQCIADKSIADCVEALLGCYLTSCGERAAQLFLCSLGLKVLPVIKRTDREKALCPTRENFNSQQKNLSVSCAAASVASSRSSVLKDSEYGCLKIPPRCMFDHPDADKTLNHLISGFENFEKKINYRFKNKAYLLQAFTHASYHYNTITDCYQRLEFLGDAILDYLITKHLYEDPRQHSPGVLTDLRSALVNNTIFASLAVKYDYHKYFKAVSPELFHVIDDFVQFQLEKNEMQGMDSELRRSEEDEEKEEDIEVPKAMGDIFESLAGAIYMDSGMSLETVWQVYYPMMRPLIEKFSANVPRSPVRELLEMEPETAKFSPAERTYDGKVRVTVEVVGKGKFKGVGRSYRIAKSAAARRALRSLKANQPQVPNS 9452B96A601D4551 pre_sirna_w1 pre_sirna_5'UGGCCUUGGGCAACGGUAAUUCGGGAUUACCGAGACCG3':5'CGGUCUCGGUAAUCCCGAAUUACCGUUGCCCAAGGCCAUU3' ds rna ds rna double stranded ribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) UGGCCUUGGGCAACGGUAAUUCGGGAUUACCGAGACCG ds_rna ds_rna_5'UGGCCUUGGGCAACGGUAAUU3':5'UUACCGGAACCCGUUGCCAUU3' ds rna ds rna double stranded ribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) UGGCCUUGGGCAACGGUAAUU trbp2_human RISC-loading complex subunit TARBP2 Trans-activation-responsive RNA-binding protein TARBP2 TRBP TAR RNA-binding protein 2 protein protein human Homo sapiens Human MSEEEQGSGTTTGCGLPSIEQMLAANPGKTPISLLQEYGTRIGKTPVYDLLKAEGQAHQPNFTFRVTVGDTSCTGQGPSKKAAKHKAAEVALKHLKGGSMLEPALEDSSSFSPLDSSLPEDIPVFTAAAAATPVPSVVLTRSPPMELQPPVSPQQSECNPVGALQELVVQKGWRLPEYTVTQESGPAHRKEFTMTCRVERFIEIGSGTSKKLAKRNAAAKMLLRVHTVPLDARDGNEVEPDDDHFSIGVGSRLDGLRNRGPGCTWDSLRNSVGEKILSLRSCSLGSLGALGPACCRVLSELSEEQAFHVSYLDIEELSLSGLCQCLVELSTQPATVCHGSATTREAARGEAARRALQYLKIMAGSK DIP protein Q15633 original sequence version: 71 DIP protein Q15633 original sequence version: 117 DIP protein Q15633 original sequence version: 99 DIP protein Q15633-1 original sequence version: 94 DIP protein Q15633 original sequence version: 122 768BA11751DA4912 pre-hsa-mir-34c pre-hsa-mir-34c ds rna ds rna double stranded ribonucleic acid human Homo sapiens Human AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU pre_sirna_w2 pre_sirna_5'UUACCGUUGCCCAAGGCCAUUCGGGAUUACCGAGACCG3':3'CGGUCUCGGUAAUCCCGAAUGGCCUUGGGCAACGGUAAUU5' ds rna ds rna double stranded ribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) UUACCGUUGCCCAAGGCCAUUCGGGAUUACCGAGACCG prkra_human Interferon-inducible double-stranded RNA-dependent protein kinase activator A Protein activator of the interferon-induced protein kinase PKR-associated protein X PKR-associating protein X HSD-14 PRKRA RAX PACT HSD14 Protein kinase, interferon-inducible double-stranded RNA-dependent activator protein protein human Homo sapiens Human MSQSRHRAEAPPLEREDSGTFSLGKMITAKPGKTPIQVLHEYGMKTKNIPVYECERSDVQIHVPTFTFRVTVGDITCTGEGTSKKLAKHRAAEAAINILKANASICFAVPDPLMPDPSKQPKNQLNPIGSLQELAIHHGWRLPEYTLSQEGGPAHKREYTTICRLESFMETGKGASKKQAKRNAAEKFLAKFSNISPENHISLTNVVGHSLGCTWHSLRNSPGEKINLLKRSLLSIPNTDYIQLLSEIAKEQGFNITYLDIDELSANGQYQCLAELSTSPITVCHGSGISCGNAQSDAAHNALQYLKIIAERK 9B01637E6194827E ds_rna-dicer1-1 2 11 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 13 unspecified role unspecified role bait bait 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 1b left panel entitled 'Dicer-TRBP' ds_rna-tarbp2-1 2 13 unspecified role unspecified role bait bait 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection direct interaction direct interaction figure 1b left panel entitled 'TRBP' ds_rna-dicer1-2 2 17 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 13 unspecified role unspecified role bait bait 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 unspecified role unspecified role prey prey purified purified region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 1b right panel section entitled 'Dicer-PACT' ds_rna-prkra-1 2 17 unspecified role unspecified role prey prey purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 13 unspecified role unspecified role bait bait 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) direct interaction direct interaction figure 1b right panel entitled 'PACT' dicer1-prkra-1 1 17 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection direct interaction direct interaction figure S3 top panel entitled 'Dicer-PACT complex' ago2-dicer1-2 3 8 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 10 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection association association figure 3a left-hand panel section entitled 'D/A/P' dicer1-pre_hsa_mir_200a-1 3 10 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2a left panel section entitled 'D/T' dicer1-pre_hsa_mir_34c-1 5 15 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2a right panel ago2-dicer1-7 5 8 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 15 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection association association figure 3a right-hand side panel labelled D/A/P dicer1-pre_hsa_mir_200a-3 3 10 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 2a left panel section entitled 'D' dicer1-pre_hsa_mir_34c-3 5 15 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 2a right panel dicer1-pre_sirna_w1-1 7 12 enzyme target enzyme target substrate substrate neutral component neutral component 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2b middle entitled 'Dicer-TRBP' dicer1-pre_sirna_w1-2 7 12 enzyme target enzyme target substrate substrate neutral component neutral component 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2b left side entitled 'Dicer-PACT' dicer1-pre_sirna_w1-3 7 12 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 2b left side dicer1-pre sirna w2-1 7 16 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 2c top left hand dicer1-pre sirna w2-2 7 16 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2c bottom right dicer1-pre sirna w2-3 7 16 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2c bottom left-hand side entitled 'Dicer-TRBP' dicer1-pre_let_7a_1-1 4 9 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 2c top left-hand ago2-dicer1-11 4 9 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 112 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection components of the RISC loading complex: Dicer, Ago2 & TRBP2 were expressed and purifed separately then incubated together to form the complex. rna cleavage rna cleavage figure 3b left-hand side entitled 'Dicer-Ago2-TRBP' dicer1-pre_let_7a_1-3 4 9 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2c bottom right-hand corner entitled 'Dicer-PACT' pre_hsa_mir_200a-risc_loading_complex_human-1 3 10 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 112 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection The complex components Dicer, Ago2 and TRBP2 were expressed and purified separately then incubated together to form the complex. rna cleavage rna cleavage figure 3a left-hand panel section entitled 'D/A/T' ago2-dicer1-6 5 15 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 112 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 3a ago2-dicer1-8 5 15 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2a right panel pre_sirna_w1-risc_loading_complex_human-1 7 12 enzyme target enzyme target substrate substrate neutral component neutral component 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 112 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection rna cleavage rna cleavage figure 3b top panel ago2-dicer1-10 7 8 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 12 enzyme target enzyme target substrate substrate neutral component neutral component 5prime Biotin tag biotin tag biotin tag certain certain sequence position certain certain certain sequence position certain 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection association association figure 3b right side entitled 'Dicer-Ago2-PACT' ago2-dicer1-12 4 9 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 14 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection physical association physical association figure 2c bottom left-hand side entitled 'Dicer-TRBP' ago2-dicer1-13 4 8 unspecified role unspecified role neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 9 enzyme target enzyme target substrate substrate neutral component neutral component 5prime 32p radiolabel 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 17 ancillary ancillary neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection 11 enzyme enzyme neutral component neutral component purified purified spofr-sf_9 Spodoptera frugiperda insect cells Fall armyworm sf_9 insect cells Derived from pupal ovarian tissue of the fall armyworm Cloned from the parent cell line, IPLB-SF-21-AE (SF-21) derived from immature ovaries of fall armyworm Spodoptera frugiperda pupae cells are susceptible to Baculovirus infection association association figure 3b bottom right-hand corner entitled 'Dicer-Ago2-PACT' tarbp2-risc_complex_human RISC-loading complex, TARBP2 variant AGO2:DICER1:TARBP2 miRLC complex RLC complex microRNA loading complex 8 enzyme enzyme dicer1_binding_region binding region binding-associated region binding region undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 11 enzyme enzyme tarbp2_binding_region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain ago2_binding_region binding region binding-associated region binding region c-term range C-terminal range c-term range c-term range C-terminal range c-term range 14 unspecified role unspecified role dicer1_binding_region binding region binding-associated region binding region certain certain sequence position certain certain certain sequence position certain 158 155 160 157 physical association physical association human Homo sapiens Human stable complex stable complex physical interaction evidence used in manual assertion physical interaction evidence used in manual assertion IPI inferred from physical interaction Endoribonclease complex that has dicing, slicing, guide-strand selection, and AGO2-loading activities. Within the trimeric complex, DICER1 and TARBP2 are required to process precursor miRNAs (pre-miRNAs) to mature miRNAs and then load them onto AGO2. AGO2-miRNA dissociates from the rest of the complex, forming the RNA-induced silencing complex (RISC). Also process pre-siRNAs. by Rachael Huntley at BHF-UCL. MW ~ 360 kDa Heterotrimer Accepted 2015-JUN-26 by BMELDAL