bhf-ucl An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti tag coip anti tag coimmunoprecipitation anti tag coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti bait coip anti bait coimmunoprecipitation anti bait coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti bait coip anti bait coimmunoprecipitation anti bait coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti bait coip anti bait coimmunoprecipitation anti bait coip rt-pcr reverse transcription pcr RT-PCR Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-293t Homo sapiens 293 cells transformed with SV40 large T antigen 293t 293 cells expressing SV40 large T antigen. The original designation of this cell line was 293tsA1609neo. It is not in Cabri,ATCC or HyperCLDB. anti bait coip anti bait coimmunoprecipitation anti bait coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. An RNA-dependent RNA polymerase formed by TERT and the RMRP RNA. Nature (0028-0836) 2009 imex curation Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu 05-Jan-2015: Contacted by IntAct-Help. Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 anti tag coip anti tag coimmunoprecipitation anti tag coip northern blot northern blot northen Maida Y., Yasukawa M., Furuuchi M., Lassmann T., Possemato R., Okamoto N., Kasim V., Hayashizaki Y., Hahn W.C., Masutomi K. Cardiac - Interactions involving cardiac related proteins Species of TERT used in experiments confirmed by abstract statement: human telomerase catalytic subunit (hTERT) . HeLa cell option chosen although authors state HeLa-S. HeLa-S3 cells available option but I don't know if HeLa-S is equivalent to HeLa-S3 William_Hahn@dfci.harvard.edu Accepted 2014-NOV-18 by ORCHARD Nature (0028-0836) 2009 Only protein-protein interactions imex curation mttg_human_trna mitochondrially encoded tRNA glycine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human ACTCTTTTAGTATAAATAGTACCGTTAACTTCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTA mttp_human_trna mitochondrially encoded tRNA proline trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human CAGAGAATAGTTTAAATTAGAATCTTAGCTTTGGGTGCTAATGGTGGAGTTAAAGACTTTTTCTCTGA ago2_human Protein argonaute-2 AGO2 Argonaute RISC catalytic component 2 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer protein protein human Homo sapiens Human MYSGAGPALAPPAPPPPIQGYAFKPPPRPDFGTSGRTIKLQANFFEMDIPKIDIYHYELDIKPEKCPRRVNREIVEHMVQHFKTQIFGDRKPVFDGRKNLYTAMPLPIGRDKVELEVTLPGEGKDRIFKVSIKWVSCVSLQALHDALSGRLPSVPFETIQALDVVMRHLPSMRYTPVGRSFFTASEGCSNPLGGGREVWFGFHQSVRPSLWKMMLNIDVSATAFYKAQPVIEFVCEVLDFKSIEEQQKPLTDSQRVKFTKEIKGLKVEITHCGQMKRKYRVCNVTRRPASHQTFPLQQESGQTVECTVAQYFKDRHKLVLRYPHLPCLQVGQEQKHTYLPLEVCNIVAGQRCIKKLTDNQTSTMIRATARSAPDRQEEISKLMRSASFNTDPYVREFGIMVKDEMTDVTGRVLQPPSILYGGRNKAIATPVQGVWDMRNKQFHTGIEIKVWAIACFAPQRQCTEVHLKSFTEQLRKISRDAGMPIQGQPCFCKYAQGADSVEPMFRHLKNTYAGLQLVVVILPGKTPVYAEVKRVGDTVLGMATQCVQMKNVQRTTPQTLSNLCLKINVKLGGVNNILLPQGRPPVFQQPVIFLGADVTHPPAGDGKKPSIAAVVGSMDAHPNRYCATVRVQQHRQEIIQDLAAMVRELLIQFYKSTRFKPTRIIFYRDGVSEGQFQQVLHHELLAIREACIKLEKDYQPGITFIVVQKRHHTRLFCTDKNERVGKSGNIPAGTTVDTKITHPTEFDFYLCSHAGIQGTSRPSHYHVLWDDNRFSSDELQILTYQLCHTYVRCTRSVSIPAPAYYAHLVAFRARYHLVDKEHDSAEGSHTSGQSNGRDHQALAKAVQVHQDTLRTMYFA DIP protein Q9UKV8 original sequence version: 1(def) DIP protein Q9UKV8 original sequence version: 44 DIP protein Q9UKV8 original sequence version: 60 DIP protein Q9UKV8 original sequence version: 62 DIP protein Q9UKV8 original sequence version: 89 DIP protein Q9UKV8 original sequence version: 85 DIP protein Q9UKV8 original sequence version: 87 DIP protein Q9UKV8 original sequence version: 99 DIP protein Q9UKV8 original sequence version: 117 DIP protein Q9UKV8-1 original sequence version: 117 DIP protein Q9UKV8 original sequence version: 145 DIP protein Q9UKV8 original sequence version: 108 5C8552C43FC81345 mttd_human_trna Mitochondrially encoded tRNA aspartic acid trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human AGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCTAAATCCTATATATCTTA rmrp_human_rna RNA component of mitochondrial RNA processing endoribonuclease snorna small nucleolar rna snoRNA snorna human Homo sapiens Human GGTTCGTGCTGAAGGCCTGTATCCTAGGCTACACACTGAGGACTCTGTTCCTCCCCTTTCCGCCTAGGGGAAAGTCCCCGGACCTCGGGCAGAGAGTGCCACGTGCATACGCACGTAGACATTCCCCGCTTCCCACTCCAAAGTCCGCCAAGAAGCGTATCCCGCTGAGCGGCGTGGCGCGGGGGCGTCATCCGTCAGCTCCCTCTAGTTACGCAGGCAGTGCGTGTCCGCGCACCAACCACACGGGGCTCATTCTCAGCGCGGCTGT tert_human Telomerase reverse transcriptase TERT EST2 TCS1 TRT Telomerase catalytic subunit HEST2 Telomerase-associated protein 2 protein protein human Homo sapiens Human MPRAPRCRAVRSLLRSHYREVLPLATFVRRLGPQGWRLVQRGDPAAFRALVAQCLVCVPWDARPPPAAPSFRQVSCLKELVARVLQRLCERGAKNVLAFGFALLDGARGGPPEAFTTSVRSYLPNTVTDALRGSGAWGLLLRRVGDDVLVHLLARCALFVLVAPSCAYQVCGPPLYQLGAATQARPPPHASGPRRRLGCERAWNHSVREAGVPLGLPAPGARRRGGSASRSLPLPKRPRRGAAPEPERTPVGQGSWAHPGRTRGPSDRGFCVVSPARPAEEATSLEGALSGTRHSHPSVGRQHHAGPPSTSRPPRPWDTPCPPVYAETKHFLYSSGDKEQLRPSFLLSSLRPSLTGARRLVETIFLGSRPWMPGTPRRLPRLPQRYWQMRPLFLELLGNHAQCPYGVLLKTHCPLRAAVTPAAGVCAREKPQGSVAAPEEEDTDPRRLVQLLRQHSSPWQVYGFVRACLRRLVPPGLWGSRHNERRFLRNTKKFISLGKHAKLSLQELTWKMSVRDCAWLRRSPGVGCVPAAEHRLREEILAKFLHWLMSVYVVELLRSFFYVTETTFQKNRLFFYRKSVWSKLQSIGIRQHLKRVQLRELSEAEVRQHREARPALLTSRLRFIPKPDGLRPIVNMDYVVGARTFRREKRAERLTSRVKALFSVLNYERARRPGLLGASVLGLDDIHRAWRTFVLRVRAQDPPPELYFVKVDVTGAYDTIPQDRLTEVIASIIKPQNTYCVRRYAVVQKAAHGHVRKAFKSHVSTLTDLQPYMRQFVAHLQETSPLRDAVVIEQSSSLNEASSGLFDVFLRFMCHHAVRIRGKSYVQCQGIPQGSILSTLLCSLCYGDMENKLFAGIRRDGLLLRLVDDFLLVTPHLTHAKTFLRTLVRGVPEYGCVVNLRKTVVNFPVEDEALGGTAFVQMPAHGLFPWCGLLLDTRTLEVQSDYSSYARTSIRASLTFNRGFKAGRNMRRKLFGVLRLKCHSLFLDLQVNSLQTVCTNIYKILLLQAYRFHACVLQLPFHQQVWKNPTFFLRVISDTASLCYSILKAKNAGMSLGAKGAAGPLPSEAVQWLCHQAFLLKLTRHRVTYVPLLGSLRTAQTQLSRKLPGTTLTALEAAANPALPSDFKTILD DIP protein O14746 original sequence version: 129 DIP protein O14746 original sequence version: 95 DIP protein O14746 original sequence version: 125 DIP protein O14746 original sequence version: 121 DIP protein O14746-1 original sequence version: 110 94E35469C4CA33A0 terc_human_rna Human telomerase RNA rna ribonucleic acid RNA rna human Homo sapiens Human GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC mttq_human_trna mitochondrially encoded tRNA glutamine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human TAGGATGGGGTGTGATAGGTGGCACGGAGAATTTTGGATTCTCAGGGATGGGTTCGATTCTCATAGTCCTAG mttr_human_trna mitochondrially encoded tRNA arginine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human TGGTATATAGTTTAAACAAAACGAATGATTTCGACTCATTAAATTATGATAATCATATTTACCAA mttv_human_trna mitochondrially encoded tRNA valine trna transfer rna transfer ribonucleic acid tRNA transfer RNA trna human Homo sapiens Human CAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGA tert-mttd-1 6 14 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 15 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey 12 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey 13 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey mt-tRNA Val 18 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey 16 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey 10 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey mt-tRNA gly 9 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey mt-tRNA arg 17 nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence unspecified role unspecified role prey prey association association Fig S2, Table S1 only included molecules in supplemental table 1 with > or equal to 99% Id tert-rmrp-4 1 15 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey 14 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association Fig 1a tert-rmrp-1 5 15 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey 14 unspecified role unspecified role bait bait 13 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association Fig 1b lower panel tert-rmrp-2 3 15 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey 14 unspecified role unspecified role bait bait 13 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey association association Fig 1b upper panel tert-rmrp-3 2 14 unspecified role unspecified role bait bait region required to bind necessary binding region required to bind certain certain sequence position certain certain certain sequence position certain n-terminal flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 rt-pcr reverse transcription pcr RT-PCR rt-pcr reverse transcription pcr RT-PCR unspecified role unspecified role prey prey physical association physical association Fig S4b tert-rmrp-5 7 15 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey 14 unspecified role unspecified role bait bait 13 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey association association Fig 1C lane 3 tert-rmrp-6 8 15 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey 14 unspecified role unspecified role bait bait region tap tagged calmodulin binding peptide plus protein a tag CBP-ProtA tagged CBP-ProtA tagged tap tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 13 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey association association Fig 1C lane 1 tert-rmrp-7 7 11 unspecified role unspecified role bait bait 13 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain association association Fig 5C lane 5 Annotated as an association as this should have miR-16 included as an interactor prey as well as rmrp, however it is not clear which miR-16 is ppt, there are 2 genes in human miR-16 was also observed as an interactor prey as well as rmrp, however it is not clear which miR-16 as there are 2 genes in human tert-rmrp-8 4 11 unspecified role unspecified role bait bait 13 northern blot northern blot northen northern blot northern blot northen unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain association association Fig 5C lane 3 Annotated as an association as this should have miR-16 included as an interactor prey as well as rmrp, however it is not clear which miR-16 is ppt, there are 2 genes in human miR-16 was also observed as an interactor prey as well as rmrp, however it is not clear which miR-16 as there are 2 genes in human