IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. Mol. Biol. Cell (1059-1524) 2007 Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw 22-Jan-2008: Contacted by JYOTI. DAVET human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. anti bait coip anti bait coimmunoprecipitation anti bait coip primer specific pcr primer specific pcr Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer AGS cells were treated or not treated with 10 nM EGF for 1 and 4 hours. Immunoprecipitation was carried out. RNA from immunoprecipitated complexes was extracted and subjected to RT-PCR analysis. tctseng@mail.ncku.edu.tw Accepted 2007-Not a month!-5 by DAVET. 22-Jan-2008: Contacted by JYOTI. Mol. Biol. Cell (1059-1524) 2007 DAVET EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. Mol. Biol. Cell (1059-1524) 2007 Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw 22-Jan-2008: Contacted by JYOTI. DAVET human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Accepted 2007-Not a month!-5 by DAVET. 22-Jan-2008: Contacted by JYOTI. Mol. Biol. Cell (1059-1524) 2007 DAVET EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. Mol. Biol. Cell (1059-1524) 2007 Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw 22-Jan-2008: Contacted by JYOTI. DAVET in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Accepted 2007-Not a month!-5 by DAVET. 22-Jan-2008: Contacted by JYOTI. Mol. Biol. Cell (1059-1524) 2007 DAVET EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. EGF Increases the Interaction Between Nucleolin and Heterogeneous Nuclear Ribonucleoprotein K/poly(C) Binding Protein 1 Complex to Regulate the Gastrin mRNA Turnover. Mol. Biol. Cell (1059-1524) 2007 Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw 22-Jan-2008: Contacted by JYOTI. DAVET in vitro In vitro pull down pull down ms participant Identification by mass spectrometry ms participant Lee PT., Liao PC., Chang WC., Tseng JT. Cancer - Interactions investigated in the context of cancer tctseng@mail.ncku.edu.tw Accepted 2007-Not a month!-5 by DAVET. Mol. Biol. Cell (1059-1524) 2007 DAVET probe_e_rna Probe E based on structure of human gastrin mRNA (342-369) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) CCCAGAAAUGUCCCCUGAAAAACUGA 248B07BE6004DB30 probe_c_rna Probe C based on structure of human gastrin mRNA (384-409) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) CCCAGCCCUGUCCCCUGAAAAACUGA 248B040B35523B30 probe_d_n_rna Probe D-N based on structure of human gastrin mRNA (384-409) with mutation of C-rich region rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AAAAGCCCUGUCAAAUGAAAAACUGA D68B062BBDDAB133 nucl_human Nucleolin NCL Protein C23 protein protein human Homo sapiens Human MVKLAKAGKNQGDPKKMAPPPKEVEEDSEDEEMSEDEEDDSSGEEVVIPQKKGKKAAATSAKKVVVSPTKKVAVATPAKKAAVTPGKKAAATPAKKTVTPAKAVTTPGKKGATPGKALVATPGKKGAAIPAKGAKNGKNAKKEDSDEEEDDDSEEDEEDDEDEDEDEDEIEPAAMKAAAAAPASEDEDDEDDEDDEDDDDDEEDDSEEEAMETTPAKGKKAAKVVPVKAKNVAEDEDEEEDDEDEDDDDDEDDEDDDDEDDEEEEEEEEEEPVKEAPGKRKKEMAKQKAAPEAKKQKVEGTEPTTAFNLFVGNLNFNKSAPELKTGISDVFAKNDLAVVDVRIGMTRKFGYVDFESAEDLEKALELTGLKVFGNEIKLEKPKGKDSKKERDARTLLAKNLPYKVTQDELKEVFEDAAEIRLVSKDGKSKGIAYIEFKTEADAEKTFEEKQGTEIDGRSISLYYTGEKGQNQDYRGGKNSTWSGESKTLVLSNLSYSATEETLQEVFEKATFIKVPQNQNGKSKGYAFIEFASFEDAKEALNSCNKREIEGRAIRLELQGPRGSPNARSQPSKTLFVKGLSEDTTEETLKESFDGSVRARIVTDRETGSSKGFGFVDFNSEEDAKAAKEAMEDGEIDGNKVTLDWAKPKGEGGFGGRGGGRGGFGGRGGGRGGRGGFGGRGRGGFGGRGGFRGGRGGGGDHKPQGKKTKFE DIP protein P19338 original sequence version: 93 DIP protein P19338 original sequence version: 123 C97F6E34E5CA6727 anr28_human Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit A ANKRD28 KIAA0379 Ankyrin repeat domain-containing protein 28 Phosphatase interactor targeting protein hnRNP K protein protein human Homo sapiens Human MAFLKLRDQPSLVQAIFNGDPDEVRALIFKKEDVNFQDNEKRTPLHAAAYLGDAEIIELLILSGARVNAKDSKWLTPLHRAVASCSEEAVQVLLKHSADVNARDKNWQTPLHIAAANKAVKCAEALVPLLSNVNVSDRAGRTALHHAAFSGHGEMVKLLLSRGANINAFDKKDRRAIHWAAYMGHIEVVKLLVSHGAEVTCKDKKSYTPLHAAASSGMISVVKYLLDLGVDMNEPNAYGNTPLHVACYNGQDVVVNELIDCGAIVNQKNEKGFTPLHFAAASTHGALCLELLVGNGADVNMKSKDGKTPLHMTALHGRFSRSQTIIQSGAVIDCEDKNGNTPLHIAARYGHELLINTLITSGADTAKRGIHGMFPLHLAALSGFSDCCRKLLSSGFDIDTPDDFGRTCLHAAAAGGNLECLNLLLNTGADFNKKDKFGRSPLHYAAANCNYQCLFALVGSGASVNDLDERGCTPLHYAATSDTDGKCLEYLLRNDANPGIRDKQGYNAVHYSAAYGHRLCLQLIASETPLDVLMETSGTDMLSDSDNRATISPLHLAAYHGHHQALEVLVQSLLDLDVRNSSGRTPLDLAAFKGHVECVDVLINQGASILVKDYILKRTPIHAAATNGHSECLRLLIGNAEPQNAVDIQDGNGQTPLMLSVLNGHTDCVYSLLNKGANVDAKDKWGRTALHRGAVTGHEECVDALLQHGAKCLLRDSRGRTPIHLSAACGHIGVLGALLQSAASMDANPATADNHGYTALHWACYNGHETCVELLLEQEVFQKTEGNAFSPLHCAVINDNEGAAEMLIDTLGASIVNATDSKGRTPLHAAAFTDHVECLQLLLSHNAQVNSVDSTGKTPLMMAAENGQTNTVEMLVSSASAELTLQDNSKNTALHLACSKGHETSALLILEKITDRNLINATNAALQTPLHVAARNGLTMVVQELLGKGASVLAVDENGYTPALACAPNKDVADCLALILATMMPVSSSSPLSSLTFNAINRYTNTSKTVSFEALPIMRNEPSSYCSFNNIGGEQEYLYTDVDELNDSDSETY BDB4855193364585 gastrin_human_mrna Human gastrin mRNA (full cds) mrna messenger rna mRNA mrna human Homo sapiens Human AGTCTCTGCTCTTCCCAGCCTCTCCGGCGCGCTCCAAGGGCTTCCCGTCGGGACCATGCGCGGCAGTGAGCTCCCGCTGGTCCTGCTGGCGCTGGTCCTCTGCCTAGCGCCCCGGGGGCGAGCGGTCCCGCTGCCTGCGGGCGGAGGGACCGTGCTGACCAAGATGTACCCGCGCGGCAACCACTGGGCGGTGGGGCACTTAATGGGGAAAAAGAGCACAGGGGAGTCTTCTTCTGTTTCTGAGAGAGGGAGCCTGAAGCAGCAGCTGAGAGAGTACATCAGGTGGGAAGAAGCTGCAAGGAATTTGCTGGGTCTCATAGAAGCAAAGGAGAACAGAAACCACCAGCCACCTCAACCCAAGGCCTTGGGCAATCAGCAGCCTTCGTGGGATTCAGAGGATAGCAGCAACTTCAAAGATGTAGGTTCAAAAGGCAAAGTTGGTAGACTCTCTGCTCCAGGTTCTCAACGTGAAGGAAGGAACCCCCAGCTGAACCAGCAATGATAATGATGGCCTCTCTCAAAAGAGAAAAACAAAACCCCTAAGAGACTGAGTTCTGCAAGCATCAGTTCTACGGATCATCAACAAGATTTCCTTGTGCAAAATATTTGACTATTCTGTATCTTTCATCCTTGACTAAATTCGTGATTTTCAAGCAGCATCTTCTGGTTTAAACTTGTTTGCTGTGAACAATTGTCGAAAAGAGTCTTCCAATTAATGCTTTTTTATATCTAGGCTACCTGTTGGTTAGATTCAAGGCCCCGAGCTGTTACCATTCACAATAAAAGCTTAAACACAT C5D063F6A20BD649 pcbp1_human Poly(rC)-binding protein 1 PCBP1 Alpha-CP1 Nucleic acid-binding protein SUB2.3 Heterogeneous nuclear ribonucleoprotein E1 protein protein human Homo sapiens Human MDAGVTESGLNVTLTIRLLMHGKEVGSIIGKKGESVKRIREESGARINISEGNCPERIITLTGPTNAIFKAFAMIIDKLEEDINSSMTNSTAASRPPVTLRLVVPATQCGSLIGKGGCKIKEIRESTGAQVQVAGDMLPNSTERAITIAGVPQSVTECVKQICLVMLETLSQSPQGRVMTIPYQPMPASSPVICAGGQDRCSDAAGYPHATHDLEGPPLDAYSIQGQHTISPLDLAKLNQVARQQSHFAMMHGGTGFAGIDSSSPEVKGYWASLDASTQTTHELTIPNNLIGCIIGRQGANINEIRQMSGAQIKIANPVEGSSGRQVTITGSAASISLAQYLINARLSSEKGMGCS DIP protein Q15365 original sequence version: 141 DIP protein Q15365 original sequence version: 116 6D1A261276CA206D probe_b_rna Probe B based on structure of human gastrin mRNA (366-387) rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AGCCACCUCCCACCCCACCCCA 3555825C315B47DD probe_b-ankrd28 4 11 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 12 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. association association 3 A, B To identify the trans-acting factors that may interact with the gastrin mRNA 3 UTR, the biotin pull-down assay was performed to analyze the potential proteins association with this region. Two major proteins were observed to interact with probe B and probe C (Figure 3A). Using mass spectrometry analysis, hnRNP K and PCBP1, belonging to the poly(C) binding protein family, were identified to be the target proteins interacted with the gastrin mRNA 3 UTR The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. probe_c-ankrd28 4 11 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. association association 3 A, B To identify the trans-acting factors that may interact with the gastrin mRNA 3 UTR, the biotin pull-down assay was performed to analyze the potential proteins association with this region. Two major proteins were observed to interact with probe B and probe C (Figure 3A). Using mass spectrometry analysis, hnRNP K and PCBP1, belonging to the poly(C) binding protein family, were identified to be the target proteins interacted with the gastrin mRNA 3 UTR The RNA probe based on human gastrin mRNA (384-409) was labeled with biotin. probe_c-ankrd28-1 3 11 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 9 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 6 unspecified role unspecified role bait bait association association 3 C The RNA probe based on human gastrin mRNA (384-409) was labeled with biotin. the UV cross-linking/biotin-labeled probe pull-down combined with Western-blot analysis using hnRNP K and PCBP1 antibodies were performed. The data revealed that both hnRNP K and PCBP bound with probe B and C, but not probe A probe_b-ankrd28-1 3 11 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 9 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 12 unspecified role unspecified role bait bait association association 3 C The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. the UV cross-linking/biotin-labeled probe pull-down combined with Western-blot analysis using hnRNP K and PCBP1 antibodies were performed. The data revealed that both hnRNP K and PCBP bound with probe B and C, but not probe A ankrd29-gastrin_hu 1 9 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association 3 D Human gastrin mRNA was detected in the hnRNP K and PCBP1 immunoprecipitation complexes under normal and EGF treatment at different time points The amount of associated gastrin mRNA was unchanged under EGF treatment. pcbp1-gastrin_hu-1 1 11 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association 3 D Human gastrin mRNA was detected in the hnRNP K and PCBP1 immunoprecipitation complexes under normal and EGF treatment at different time points The amount of associated gastrin mRNA was unchanged under EGF treatment. probe_b-ncl 3 12 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey physical association physical association The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 4 A We found nucleolin, a RNA-binding protein involved in many cellular processes, interacted with probes B and C, but not with probe A (Figure 4A, lanes 3-5). This result indicated that the nucleolin associates with gastrin mRNA 3 UTR in vitro. probe_c-ncl-1 3 6 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey physical association physical association The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 4 A We found nucleolin, a RNA-binding protein involved in many cellular processes, interacted with probes B and C, but not with probe A (Figure 4A, lanes 3-5). This result indicated that the nucleolin associates with gastrin mRNA 3 UTR in vitro. ncl-gastrin_hu-1 1 8 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey physical association physical association 4 B EGF - The amount of associated gastrin mRNA was slightly increased under EGF treatment for 4 hours. the in vivo association of nucleolin with gastrin mRNA was demonstrated by RNA-immunoprecipitation assay. We found that nucleolin bound to gastrin mRNA and slightly increased the binding amounts under EGF treatment for 4 hours ankrd28-ncl 2 8 unspecified role unspecified role prey prey 9 unspecified role unspecified role bait bait physical association physical association 4 D, E we found the hnRNP K immunoprecipitated complex contained the nucleolin protein, and vice versa. RNase treatment did not disrupt this interaction, indicating that the interaction is not mediated by gastrin mRNA but is a protein-protein interaction not a protein-RNA-protein interaction. EGF - This interaction increased under EGF treatment. probe_b-ankrd28-2 3 9 unspecified role unspecified role prey prey human-ags Homo sapiens caucasian gastric adenocarcinoma cell line AGS ags Human caucasian gastric adenocarcinoma cell line AGS Derived from an adenocarcinoma of the stomach of a 54 year old Caucasian female with no prior anti-cancer treatment. 12 unspecified role unspecified role bait bait 8 unspecified role unspecified role prey prey association association 5 B The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. This result indicated that nucleolin binds with gastrin mRNA not only dependent on the binding sequence but also regulated by hnRNP K/PCBP1 complex interacting with the C-rich region. Probe B bound with lower level nucleolin protein than probe C. Mutation of the C-rich region of probe B abolished the binding activity of nucleolin (Probe F). probe_c-ankrd28-2 3 6 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey 8 unspecified role unspecified role prey prey association association The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 5 B we also found the probe B bound with lower level nucleolin protein than probe C. Mutation of the putative nucleolin binding site AGCCCU to AGAAAU abolished binding of nucleolin (Probe E). probe_d_n-ankrd28-3 3 8 unspecified role unspecified role prey prey 7 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey association association The RNA probe based on human gastrin mRNA (366-387) was labeled with biotin. 5 B These results indicated the AGCCCU motif was the target site for nucleolin to bind with gastrin mRNA. Interestingly, the binding activity decreased with probe D-N. Binding of nucleolin and hnRNP K to probe D-N was decreased as compared to binding to probe B and Probe C. probe_e-ankrd28 3 9 unspecified role unspecified role prey prey 5 unspecified role unspecified role bait bait physical association physical association 5 B Nucleolin could not bind with probe E as the putative nucleolin binding site AGCCCU was mutated to AGAAAU.