IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. J. Biol. Chem. (0021-9258) 2006 imex curation Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. eric.lam@imperial.ac.uk 14-May-2008: Contacted by JYOTI. davet Only protein-protein interactions human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis eric.lam@imperial.ac.uk Accepted 2008-APR-28 by DAVET. 14-May-2008: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 davet Only protein-protein interactions imex curation The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. J. Biol. Chem. (0021-9258) 2006 imex curation Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. eric.lam@imperial.ac.uk 14-May-2008: Contacted by JYOTI. davet Only protein-protein interactions in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. eric.lam@imperial.ac.uk Accepted 2008-APR-28 by DAVET. 14-May-2008: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 davet Only protein-protein interactions imex curation The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. The Forkhead box M1 protein regulates the transcription of the estrogen receptor alpha in breast cancer cells. J. Biol. Chem. (0021-9258) 2006 imex curation Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Cancer - Interactions investigated in the context of cancer Oligonucleotides containing different Forkhead-responsive elements (FHREs)of the human Estrogen Receptor alpha (ERalpha) with 5' ends either free or conjugated to biotin. The oligonucleotides were incubated with nuclear extracts prepared from cycling MCF-7 cells. eric.lam@imperial.ac.uk 14-May-2008: Contacted by JYOTI. davet Only protein-protein interactions human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells ch-ip chromatin immunoprecipitation assay ch-ip primer specific pcr primer specific pcr Madureira PA., Varshochi R., Constantinidou D., Francis RE., Coombes RC., Yao KM., Lam EW. Apoptosis - Interactions involving proteins with a function related to apoptosis Protein-DNA complexes from cycling MCF-7 were analyzed. eric.lam@imperial.ac.uk Accepted 2008-APR-28 by DAVET. 14-May-2008: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 davet Only protein-protein interactions imex curation s1s2_human_dna S1S2 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human CAATATTTATTTATATCCAGTATTTATTTTCAATAC 78116D3AB80D8EE1 foxm1_human Forkhead box protein M1 Hepatocyte nuclear factor 3 forkhead homolog 11 Winged-helix factor from INS-1 cells M-phase phosphoprotein 2 MPM-2 reactive phosphoprotein 2 Transcription factor Trident Forkhead-related protein FKHL16 WIN FOXM1 FKHL16 HFH11 MPP2 protein protein human Homo sapiens Human MKTSPRRPLILKRRRLPLPVQNAPSETSEEEPKRSPAQQESNQAEASKEVAESNSCKFPAGIKIINHPTMPNTQVVAIPNNANIHSIITALTAKGKESGSSGPNKFILISCGGAPTQPPGLRPQTQTSYDAKRTEVTLETLGPKPAARDVNLPRPPGALCEQKRETCADGEAAGCTINNSLSNIQWLRKMSSDGLGSRSIKQEMEEKENCHLEQRQVKVEEPSRPSASWQNSVSERPPYSYMAMIQFAINSTERKRMTLKDIYTWIEDHFPYFKHIAKPGWKNSIRHNLSLHDMFVRETSANGKVSFWTIHPSANRYLTLDQVFKPLDPGSPQLPEHLESQQKRPNPELRRNMTIKTELPLGARRKMKPLLPRVSSYLVPIQFPVNQSLVLQPSVKVPLPLAASLMSSELARHSKRVRIAPKVLLAEEGIAPLSSAGPGKEEKLLFGEGFSPLLPVQTIKEEEIQPGEEMPHLARPIKVESPPLEEWPSPAPSFKEESSHSWEDSSQSPTPRPKKSYSGLRSPTRCVSEMLVIQHRERRERSRSRRKQHLLPPCVDEPELLFSEGPSTSRWAAELPFPADSSDPASQLSYSQEVGGPFKTPIKETLPISSTPSKSVLPRTPESWRLTPPAKVGGLDFSPVQTSQGASDPLPDPLGLMDLSTTPLQSAPPLESPQRLLSSEPLDLISVPFGNSSPSDIDVPKPGSPEPQVSGLAANRSLTEGLVLDTMNDSLSKILLDISFPGLDEDPLGPDNINWSQFIPELQ DIP protein Q08050 original sequence version: 142 963CAC8FE7498E9B s4_human_dna S4 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human ATTTTTCACATGTTTACAGAAAGCAGTCAACTGAGC 4B42C26A60DBE845 s8_human_dna S8 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human ATCGAGTTGTGCCTGGAGTGATGTTTAAGCCAATGTCAGGGCAAGG 16866C57B0AB043C s6s7_human_dna S6S7 oligonucleotide containing Forkhead response element based on human ERalpha promoter ds dna double stranded deoxyribonucleic acid ds DNA ds dna human Homo sapiens Human GAGGAGGGGGAATCAAACAGAAAGAGAGACAAACAGAGATATATC AF75F8DA91FEE886 eralpha_human_gene Human estrogen receptor alpha gene gene human Homo sapiens Human foxo3_human Forkhead box protein O3 FOXO3 FKHRL1 FOXO3A Forkhead in rhabdomyosarcoma-like 1 AF6q21 protein protein protein human Homo sapiens Human MAEAPASPAPLSPLEVELDPEFEPQSRPRSCTWPLQRPELQASPAKPSGETAADSMIPEEEDDEDDEDGGGRAGSAMAIGGGGGSGTLGSGLLLEDSARVLAPGGQDPGSGPATAAGGLSGGTQALLQPQQPLPPPQPGAAGGSGQPRKCSSRRNAWGNLSYADLITRAIESSPDKRLTLSQIYEWMVRCVPYFKDKGDSNSSAGWKNSIRHNLSLHSRFMRVQNEGTGKSSWWIINPDGGKSGKAPRRRAVSMDNSNKYTKSRGRAAKKKAALQTAPESADDSPSQLSKWPGSPTSRSSDELDAWTDFRSRTNSNASTVSGRLSPIMASTELDEVQDDDAPLSPMLYSSSASLSPSVSKPCTVELPRLTDMAGTMNLNDGLTENLMDDLLDNITLPPSQPSPTGGLMQRSSSFPYTTKGSGLGSPTSSFNSTVFGPSSLNSLRQSPMQTIQENKPATFSSMSHYGNQTLQDLLTSDSLSHSDVMMTQSDPLMSQASTAVSAQNSRRNVMLRNDPMMSFAAQPNQGSLVNQNLLHHQHQTQGALGGSRALSNSVSNMGLSESSSLGSAKHQQQSPVSQSMQTLSDSLSGSSLYSTSANLPVMGHEKFPSDLDLDMFNGSLECDMESIIRSELMDADGLDFNFDSLISTQNVVGLNVGNFTGAKQASSQSWVPG E5B4E830665A9982 DIP protein O43524 original sequence version: 82 E5B4E830665A9982 s1s2_human-foxm1 2 4 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S1S2 in a concentration-dependent manner. s4_human-foxm1 2 6 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S4 in a concentration-dependent manner. s6s7_human-foxm1 2 5 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells 8 unspecified role unspecified role bait bait physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S6S7 in a concentration-dependent manner. s8_human-foxm1 2 7 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXM1 binding to S8 in a concentration-dependent manner. s1s2_human-foxo3 2 10 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells 4 unspecified role unspecified role bait bait physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S1S2 in a concentration-dependent manner. s4_human-foxo3 2 10 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells 6 unspecified role unspecified role bait bait physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S4 in a concentration-dependent manner. s6s7_human-foxo3 2 8 unspecified role unspecified role bait bait 10 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S6S7 in a concentration-dependent manner. s8_human-foxo3 2 10 unspecified role unspecified role prey prey human-mcf7 Homo sapiens mammary carcinoma cells mcf7 mammary carcinoma cells 7 unspecified role unspecified role bait bait physical association physical association 5 A The result showed that FoxM1 bound to the S1/S2, S4, S6/S7, and S8 FHREs containing oligonucleotides The oligonucleotide was biotinylated. A non-biotinylated FHRE-containing oligonucleotide competed off FOXO3 binding to S8 in a concentration-dependent manner. foxo3-eralpha_hum 3 10 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey association association 5 B both the anti-FoxM1 and anti-FoxO3a antibodies, but not the control antibodies (IgGs), precipitated the ER promoter regions containing the S1/S2, S4, and S6/S7 FHREs. FOXO3 bound the region of the ERalpha promoter containing the S1/S2, S4 and S6/S7 FHREs. foxm1-eralpha_hum-1 3 5 unspecified role unspecified role bait bait 9 unspecified role unspecified role prey prey association association 5 B both the anti-FoxM1 and anti-FoxO3a antibodies, but not the control antibodies (IgGs), precipitated the ER promoter regions containing the S1/S2, S4, and S6/S7 FHREs. FOXM1 bound the region of the ERalpha promoter containing the S1/S2, S4 and S6/S7 FHREs. foxo3-foxm1 1 10 unspecified role unspecified role bait bait 5 unspecified role unspecified role prey prey physical association physical association 6 These results showed that the endogenous FoxM1 and FoxO3a proteins coprecipitated with one another in MCF-7 cells, thus confirming in vivo interaction between FoxM1 and FoxO3a. foxm1-foxo3 1 10 unspecified role unspecified role prey prey 5 unspecified role unspecified role bait bait physical association physical association 6 These results showed that the endogenous FoxM1 and FoxO3a proteins coprecipitated with one another in MCF-7 cells, thus confirming in vivo interaction between FoxM1 and FoxO3a.