IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. Biochem. Biophys. Res. Commun. (0006-291X) 2000 imex curation Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Human neuroblastoma cell line SH-SY5Y cDNA library Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Accepted 2006-JUN-28 by JYOTI. Human neuroblastoma cell line SH-SY5Y cDNA library Biochem. Biophys. Res. Commun. (0006-291X) 2000 Only protein-protein interactions imex curation HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. Biochem. Biophys. Res. Commun. (0006-291X) 2000 imex curation Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Human neuroblastoma cell line SH-SY5Y cDNA library Only protein-protein interactions in vitro In vitro pull down pull down predetermined predetermined participant predetermined Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Accepted 2006-JUN-28 by JYOTI. Human neuroblastoma cell line SH-SY5Y cDNA library Biochem. Biophys. Res. Commun. (0006-291X) 2000 Only protein-protein interactions imex curation HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. Biochem. Biophys. Res. Commun. (0006-291X) 2000 imex curation Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Human neuroblastoma cell line SH-SY5Y cDNA library Only protein-protein interactions human-sk_n_be(2) Human caucasian neuroblastoma cell line sk_n_be(2) Human neuroblastoma cell line pull down pull down western blot western blot Immuno blot Immuno blot Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Accepted 2006-JUN-28 by JYOTI. Human neuroblastoma cell line SH-SY5Y cDNA library Biochem. Biophys. Res. Commun. (0006-291X) 2000 Only protein-protein interactions imex curation HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. Biochem. Biophys. Res. Commun. (0006-291X) 2000 imex curation Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Human neuroblastoma cell line SH-SY5Y cDNA library Only protein-protein interactions yeasx Saccharomyces cerevisiae (Baker's yeast) Baker's yeast 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid full dna sequence full identification by DNA sequencing full dna sequence Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Accepted 2006-JUN-28 by JYOTI. Human neuroblastoma cell line SH-SY5Y cDNA library Biochem. Biophys. Res. Commun. (0006-291X) 2000 Only protein-protein interactions imex curation HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. HASH-1 and E2-2 are expressed in human neuroblastoma cells and form a functional complex. Biochem. Biophys. Res. Commun. (0006-291X) 2000 imex curation Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer hakan.axelson@molmed.mas.lu.se Human neuroblastoma cell line SH-SY5Y cDNA library Only protein-protein interactions human-hela Homo sapiens epitheloid cervix carcinoma cells Human hela Human epitheloid cervix carcinoma HeLa cells derivation: cervix; epithelial; adenocarcinoma ATCC no:CCL-2 2 hybrid two hybrid 2H 2h Gal4 transcription regeneration two-hybrid yeast two hybrid 2-hybrid classical two hybrid classical two hybrid 2H two-hybrid 2-hybrid Gal4 transcription regeneration 2h yeast two hybrid Y2H Y-2H 2 hybrid predetermined predetermined participant predetermined Persson P., Jogi A., Grynfeld A., Pahlman S., Axelson H. Cancer - Interactions investigated in the context of cancer Three independent experiments were performed hakan.axelson@molmed.mas.lu.se Accepted 2006-JUN-28 by JYOTI. Human neuroblastoma cell line SH-SY5Y cDNA library Biochem. Biophys. Res. Commun. (0006-291X) 2000 Only protein-protein interactions imex curation ascl1_human Achaete-scute homolog 1 ASCL1 ASH1 BHLHA46 HASH1 Class A basic helix-loop-helix protein 46 protein protein human Homo sapiens Human MESSAKMESGGAGQQPQPQPQQPFLPPAACFFATAAAAAAAAAAAAAQSAQQQQQQQQQQQQAPQLRPAADGQPSGGGHKSAPKQVKRQRSSSPELMRCKRRLNFSGFGYSLPQQQPAAVARRNERERNRVKLVNLGFATLREHVPNGAANKKMSKVETLRSAVEYIRALQQLLDEHDAVSAAFQAGVLSPTISPNYSNDLNSMAGSPVSSYSSDEGSYDPLSPEEQELLDFTNWF A7D784329305B49A tfe2_human Transcription factor E2-alpha Immunoglobulin enhancer-binding factor E12/E47 Transcription factor 3 Immunoglobulin transcription factor 1 Transcription factor ITF-1 Kappa-E2-binding factor TCF3 E2A ITF1 BHLHB21 Class B basic helix-loop-helix protein 21 protein protein human Homo sapiens Human MNQPQRMAPVGTDKELSDLLDFSMMFPLPVTNGKGRPASLAGAQFGGSGLEDRPSSGSWGSGDQSSSSFDPSRTFSEGTHFTESHSSLSSSTFLGPGLGGKSGERGAYASFGRDAGVGGLTQAGFLSGELALNSPGPLSPSGMKGTSQYYPSYSGSSRRRAADGSLDTQPKKVRKVPPGLPSSVYPPSSGEDYGRDATAYPSAKTPSSTYPAPFYVADGSLHPSAELWSPPGQAGFGPMLGGGSSPLPLPPGSGPVGSSGSSSTFGGLHQHERMGYQLHGAEVNGGLPSASSFSSAPGATYGGVSSHTPPVSGADSLLGSRGTTAGSSGDALGKALASIYSPDHSSNNFSSSPSTPVGSPQGLAGTSQWPRAGAPGALSPSYDGGLHGLQSKIEDHLDEAIHVLRSHAVGTAGDMHTLLPGHGALASGFTGPMSLGGRHAGLVGGSHPEDGLAGSTSLMHNHAALPSQPGTLPDLSRPPDSYSGLGRAGATAAASEIKREEKEDEENTSAADHSEEEKKELKAPRARTSPDEDEDDLLPPEQKAEREKERRVANNARERLRVRDINEAFKELGRMCQLHLNSEKPQTKLLILHQAVSVILNLEQQVRERNLNPKAACLKRREEEKVSGVVGDPQMVLSAPHPGLSEAHNPAGHM DIP protein P15923 original sequence version: 171 DIP protein P15923 original sequence version: 132 DIP protein P15923 original sequence version: 126 52F5E3DE1890AE13 itf2_human Transcription factor 4 Immunoglobulin transcription factor 2 SL3-3 enhancer factor 2 ITF2 SEF2 TCF4 BHLHB19 Class B basic helix-loop-helix protein 19 protein protein human Homo sapiens Human MHHQQRMAALGTDKELSDLLDFSAMFSPPVSSGKNGPTSLASGHFTGSNVEDRSSSGSWGNGGHPSPSRNYGDGTPYDHMTSRDLGSHDNLSPPFVNSRIQSKTERGSYSSYGRESNLQGCHQQSLLGGDMDMGNPGTLSPTKPGSQYYQYSSNNPRRRPLHSSAMEVQTKKVRKVPPGLPSSVYAPSASTADYNRDSPGYPSSKPATSTFPSSFFMQDGHHSSDPWSSSSGMNQPGYAGMLGNSSHIPQSSSYCSLHPHERLSYPSHSSADINSSLPPMSTFHRSGTNHYSTSSCTPPANGTDSIMANRGSGAAGSSQTGDALGKALASIYSPDHTNNSFSSNPSTPVGSPPSLSAGTAVWSRNGGQASSSPNYEGPLHSLQSRIEDRLERLDDAIHVLRNHAVGPSTAMPGGHGDMHGIIGPSHNGAMGGLGSGYGTGLLSANRHSLMVGTHREDGVALRGSHSLLPNQVPVPQLPVQSATSPDLNPPQDPYRGMPPGLQGQSVSSGSSEIKSDDEGDENLQDTKSSEDKKLDDDKKDIKSITSNNDDEDLTPEQKAEREKERRMANNARERLRVRDINEAFKELGRMVQLHLKSDKPQTKLLILHQAVAVILSLEQQVRERNLNPKAACLKRREEEKVSSEPPPLSLAGPHPGMGDASNHMGQM DIP protein P15884 original sequence version: 159 DIP protein P15884 original sequence version: 93 DIP protein P15884 original sequence version: 116 53459FC7989D9487 dna-1 Muscle creatine kinase enhancer E-box dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid human Homo sapiens Human GATCCCCCCAACACCTGCTGCCTGA 1593552634BAF31A hash1-e2_2-1 4 8 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association 1 hash1-e2_2-2 2 8 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) direct interaction direct interaction 2 hash1-e2_2-3 5 8 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined [EBI-957128]Certain and ragged-n-terminus positions must always be strictly superior to 0 and inferior or equal to the protein sequence length. Actual positions : 668-668, sequence length 667 [EBI-957128]1-668 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association 3 e2_2-hash1-1 5 6 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 8 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined [EBI-957137]Certain and ragged-n-terminus positions must always be strictly superior to 0 and inferior or equal to the protein sequence length. Actual positions : 668-668, sequence length 667 [EBI-957137]1-668 physical association physical association 3 hash1-e47-1 5 7 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 6 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association 3 e47-hash1-1 5 6 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain 7 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain physical association physical association 3 e2_2-e2_2-1 5 8 unspecified role unspecified role prey prey region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined [EBI-957168]Certain and ragged-n-terminus positions must always be strictly superior to 0 and inferior or equal to the protein sequence length. Actual positions : 668-668, sequence length 667 [EBI-957168]1-668 8 unspecified role unspecified role bait bait region sufficient to bind sufficient binding region sufficient to bind undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined [EBI-957165]Certain and ragged-n-terminus positions must always be strictly superior to 0 and inferior or equal to the protein sequence length. Actual positions : 668-668, sequence length 667 [EBI-957165]1-668 physical association physical association 3 ebox-hash1-e2_2-1 1 9 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 8 unspecified role unspecified role neutral component neutral component 6 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain direct interaction direct interaction 4 ebox-e2_2-1 1 8 unspecified role unspecified role neutral component neutral component 9 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4 ebox-e47-1 1 7 unspecified role unspecified role neutral component neutral component 9 unspecified role unspecified role neutral component neutral component region 32p radiolabel 32p radiolabel P32 32P 32P P32 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction 4 hash1-e2_2-4 3 8 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) physical association physical association 7B hash1-e47-2 3 7 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) physical association physical association 7B hash1-e2_2-5 3 8 unspecified role unspecified role prey prey region 35s radiolabel 35s radiolabel 35S s35 radiolabelled S35 s35 radiolabelled 35S S35 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecobb Escherichia coli (strain B / BL21) physical association physical association 7C