IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ Binding of manumycin A inhibits IkappaB kinase beta activity. Binding of manumycin A inhibits IkappaB kinase beta activity. J. Biol. Chem. (0021-9258) 2006 imex curation Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov 24-JAN-2007: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro protein kinase assay protein kinase assay predetermined predetermined participant predetermined Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Additional details on substrate taken from vendors website Serum-starved HepG2 cells were left untreated or treated with 10 �M manumycin for 30 min before the addition of 20 ng/ml TNF for 5 min. Extracts were immunoprecipitated with a polyclonal antibody directed against IKKbeta or IKKgamma, and solid phase kinase assays were performed. Reactions were separated by SDS-PAGE, transferred to PVDF membrane, and exposed to film to detect phosphorylated substrate. Bernierm@grc.nia.nih.gov Accepted 2006-AUG-25 by DAVET. 24-JAN-2007: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Binding of manumycin A inhibits IkappaB kinase beta activity. Binding of manumycin A inhibits IkappaB kinase beta activity. J. Biol. Chem. (0021-9258) 2006 imex curation Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov 24-JAN-2007: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro emsa electrophoretic mobility shift assay Gel retardation assay band shift band shift Gel retardation assay emsa predetermined predetermined participant predetermined Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov Accepted 2006-AUG-25 by DAVET. J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Binding of manumycin A inhibits IkappaB kinase beta activity. Binding of manumycin A inhibits IkappaB kinase beta activity. J. Biol. Chem. (0021-9258) 2006 imex curation Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov 24-JAN-2007: Contacted by JYOTI. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti tag coip anti tag coimmunoprecipitation anti tag coip western blot western blot Immuno blot Immuno blot Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov Accepted 2006-AUG-25 by DAVET. 24-JAN-2007: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation Binding of manumycin A inhibits IkappaB kinase beta activity. Binding of manumycin A inhibits IkappaB kinase beta activity. J. Biol. Chem. (0021-9258) 2006 imex curation Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov 24-JAN-2007: Contacted by JYOTI. Only protein-protein interactions human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). anti bait coip anti bait coimmunoprecipitation anti bait coip western blot western blot Immuno blot Immuno blot Bernier M., Kwon YK., Pandey SK., Zhu TN., Zhao RJ., Maciuk A., He HJ., Decabo R., Kole S. BioCreative - Critical Assessment of Information Extraction systems in Biology Bernierm@grc.nia.nih.gov Accepted 2006-AUG-25 by DAVET. 24-JAN-2007: Contacted by JYOTI. J. Biol. Chem. (0021-9258) 2006 Only protein-protein interactions imex curation ikkb_mouse Inhibitor of nuclear factor kappa-B kinase subunit beta I-kappa-B kinase 2 Nuclear factor NF-kappa-B inhibitor kinase beta Ikbkb Ikkb Serine/threonine protein kinase IKBKB protein protein mouse Mus musculus Mouse MSWSPSLPTQTCGAWEMKERLGTGGFGNVIRWHNQATGEQIAIKQCRQELSPKNRNRWCLEIQIMRRLNHPNVVAARDVPEGMQNLAPNDLPLLAMEYCQGGDLRRYLNQFENCCGLREGAVLTLLSDIASALRYLHENRIIHRDLKPENIVLQQGEKRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQQKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHSKVRQKSEVDIVVSEDLNGAVKFSSSLPFPNNLNSVLAERLEKWLQLMLMWHPRQRGTDPQYGPNGCFRALDDILNLKLVHVLNMVTGTVHTYPVTEDESLQSLKTRIQENTGILETDQELLQKAGLVLLPDKPATQCISDSKTNEGLTLDMDLVFLLDNSKINYETQITPRPPPESVSCILQEPKRNLSFFQLRKVWGQVWHSIQTLKEDCNRLQQGQRAAMMSLLRNNSCLSKMKNAMASTAQQLKAKLDFFKTSIQIDLEKYKEQTEFGITSDKLLLAWREMEQAVEQCGRENDVKHLVERMMALQTDIVDLQRSPMGRKQGGTLDDLEEQARELYRKLREKPRDQRTEGDSQEMVRLLLQAIQSFEKKVRVIYTQLSKTVVCKQKALELLPKVEEVVSLMNEDERTVVRLQEKRQKELWNLLKIACSKVRGPVSGSPDSMNVSRLSHPGQLMSQPSSACDSLPESDKKSEELVAEAHALCSRLESALQDTVKEQDRSFTTLDWSWLQMEDEERCSLEQACD DIP protein O88351 original sequence version: 126 DIP protein O88351 original sequence version: 73 DIP protein O88351 original sequence version: 99 DIP protein O88351 original sequence version: 114 DIP protein O88351 original sequence version: 149 FED962F095449C5E ikkb_human Inhibitor of nuclear factor kappa-B kinase subunit beta IKBKB IKKB I-kappa-B kinase 2 Nuclear factor NF-kappa-B inhibitor kinase beta Serine/threonine protein kinase IKBKB protein protein human Homo sapiens Human MSWSPSLTTQTCGAWEMKERLGTGGFGNVIRWHNQETGEQIAIKQCRQELSPRNRERWCLEIQIMRRLTHPNVVAARDVPEGMQNLAPNDLPLLAMEYCQGGDLRKYLNQFENCCGLREGAILTLLSDIASALRYLHENRIIHRDLKPENIVLQQGEQRLIHKIIDLGYAKELDQGSLCTSFVGTLQYLAPELLEQQKYTVTVDYWSFGTLAFECITGFRPFLPNWQPVQWHSKVRQKSEVDIVVSEDLNGTVKFSSSLPYPNNLNSVLAERLEKWLQLMLMWHPRQRGTDPTYGPNGCFKALDDILNLKLVHILNMVTGTIHTYPVTEDESLQSLKARIQQDTGIPEEDQELLQEAGLALIPDKPATQCISDGKLNEGHTLDMDLVFLFDNSKITYETQISPRPQPESVSCILQEPKRNLAFFQLRKVWGQVWHSIQTLKEDCNRLQQGQRAAMMNLLRNNSCLSKMKNSMASMSQQLKAKLDFFKTSIQIDLEKYSEQTEFGITSDKLLLAWREMEQAVELCGRENEVKLLVERMMALQTDIVDLQRSPMGRKQGGTLDDLEEQARELYRRLREKPRDQRTEGDSQEMVRLLLQAIQSFEKKVRVIYTQLSKTVVCKQKALELLPKVEEVVSLMNEDEKTVVRLQEKRQKELWNLLKIACSKVRGPVSGSPDSMNASRLSQPGQLMSQPSTASNSLPEPAKKSEELVAEAHNLCTLLENAIQDTVREQDQSFTALDWSWLQTEEEEHSCLEQAS DIP protein O14920 original sequence version: 89 DIP protein O14920 original sequence version: 100 DIP protein O14920 original sequence version: 121 DIP protein O14920 original sequence version: 126 DIP protein O14920 original sequence version: 136 DIP protein O14920 original sequence version: 128 DIP protein O14920-1 original sequence version: 151 DIP protein O14920 original sequence version: 142 DIP protein O14920 original sequence version: 159 DIP protein O14920 original sequence version: 93 DIP protein O14920 original sequence version: 124 DIP protein O14920-1 original sequence version: 178 DIP protein O14920 original sequence version: 85 F9CADF671AE9E14E ikka_human Inhibitor of nuclear factor kappa-B kinase subunit alpha CHUK IKKA TCF16 I-kappa-B kinase 1 Conserved helix-loop-helix ubiquitous kinase Nuclear factor NF-kappa-B inhibitor kinase alpha Transcription factor 16 protein protein human Homo sapiens Human MERPPGLRPGAGGPWEMRERLGTGGFGNVCLYQHRELDLKIAIKSCRLELSTKNRERWCHEIQIMKKLNHANVVKACDVPEELNILIHDVPLLAMEYCSGGDLRKLLNKPENCCGLKESQILSLLSDIGSGIRYLHENKIIHRDLKPENIVLQDVGGKIIHKIIDLGYAKDVDQGSLCTSFVGTLQYLAPELFENKPYTATVDYWSFGTMVFECIAGYRPFLHHLQPFTWHEKIKKKDPKCIFACEEMSGEVRFSSHLPQPNSLCSLVVEPMENWLQLMLNWDPQQRGGPVDLTLKQPRCFVLMDHILNLKIVHILNMTSAKIISFLLPPDESLHSLQSRIERETGINTGSQELLSETGISLDPRKPASQCVLDGVRGCDSYMVYLFDKSKTVYEGPFASRSLSDCVNYIVQDSKIQLPIIQLRKVWAEAVHYVSGLKEDYSRLFQGQRAAMLSLLRYNANLTKMKNTLISASQQLKAKLEFFHKSIQLDLERYSEQMTYGISSEKMLKAWKEMEEKAIHYAEVGVIGYLEDQIMSLHAEIMELQKSPYGRRQGDLMESLEQRAIDLYKQLKHRPSDHSYSDSTEMVKIIVHTVQSQDRVLKELFGHLSKLLGCKQKIIDLLPKVEVALSNIKEADNTVMFMQGKRQKEIWHLLKIACTQSSARSLVGSSLEGAVTPQTSAWLPPTSAEHDHSLSCVVTPQDGETSAQMIEENLNCLGHLSTIIHEANEEQGNSMMNLDWSWLTE DIP protein O15111 original sequence version: 91 DIP protein O15111 original sequence version: 123 DIP protein O15111 original sequence version: 133 DIP protein O15111 original sequence version: 118 DIP protein O15111 original sequence version: 125 DIP protein O15111 original sequence version: 96 4EA55C6FFC66FA16 nemo_human NF-kappa-B essential modulator IKBKG FIP3 NEMO NF-kappa-B essential modifier Inhibitor of nuclear factor kappa-B kinase subunit gamma IkB kinase-associated protein 1 FIP-3 protein protein human Homo sapiens Human MNRHLWKSQLCEMVQPSGGPAADQDVLGEESPLGKPAMLHLPSEQGAPETLQRCLEENQELRDAIRQSNQILRERCEELLHFQASQREEKEFLMCKFQEARKLVERLGLEKLDLKRQKEQALREVEHLKRCQQQMAEDKASVKAQVTSLLGELQESQSRLEAATKECQALEGRARAASEQARQLESEREALQQQHSVQVDQLRMQGQSVEAALRMERQAASEEKRKLAQLQVAYHQLFQEYDNHIKSSVVGSERKRGMQLEDLKQQLQQAEEALVAKQEVIDKLKEEAEQHKIVMETVPVLKAQADIYKADFQAERQAREKLAEKKELLQEQLEQLQREYSKLKASCQESARIEDMRKRHVEVSQAPLPPAPAYLSSPLALPSQRRSPPEEPPDFCCPKCQYQAPDMDTLQIHVMECIE DIP protein Q9Y6K9 original sequence version: 85 DIP protein Q9Y6K9 original sequence version: 118 DIP protein Q9Y6K9 original sequence version: 123 DIP protein Q9Y6K9 original sequence version: 141 DIP protein Q9Y6K9 original sequence version: 125 DIP protein Q9Y6K9 original sequence version: 156 DIP protein Q9Y6K9 original sequence version: 83 DIP protein Q9Y6K9 original sequence version: 132 DIP protein Q9Y6K9 original sequence version: 124 DIP protein Q9Y6K9 original sequence version: 90 322D1037881447FF ikba_human NF-kappa-B inhibitor alpha NFKBIA IKBA MAD3 NFKBI I-kappa-B-alpha Major histocompatibility complex enhancer-binding protein MAD3 protein protein human Homo sapiens Human MFQAAERPQEWAMEGPRDGLKKERLLDDRHDSGLDSMKDEEYEQMVKELQEIRLEPQEVPRGSEPWKQQLTEDGDSFLHLAIIHEEKALTMEVIRQVKGDLAFLNFQNNLQQTPLHLAVITNQPEIAEALLGAGCDPELRDFRGNTPLHLACEQGCLASVGVLTQSCTTPHLHSILKATNYNGHTCLHLASIHGYLGIVELLVSLGADVNAQEPCNGRTALHLAVDLQNPDLVSLLLKCGADVNRVTYQGYSPYQLTWGRPSTRIQQQLGQLTLENLQMLPESEDEESYDTESEFTEFTEDELPYDDCVFGGQRLTL DIP protein P25963 original sequence version: 160 DIP protein P25963 original sequence version: 157 DIP protein P25963 original sequence version: 145 DIP protein P25963 original sequence version: 170 DIP protein P25963 original sequence version: 122 DIP protein P25963 original sequence version: 128 DIP protein P25963 original sequence version: 78 DIP protein P25963 original sequence version: 121 DIP protein P25963 original sequence version: 124 088B313226786395 tf65 Chinese hamster TF65 protein protein crigr Cricetulus griseus (Chinese hamster) Cricetulus barabensis griseus Chinese hamster An amino acid sequence which is not represented in UniProt kabbab site double-stranded oligonucleotide encompassing a putative kappa-B site ds dna double stranded deoxyribonucleic acid ds DNA ds dna in vitro In vitro AATTCATGCAGTTGAGGGGACTTTCCCAGGCATGCA 88E1928CA0315FA9 kappab-tf65 2 11 unspecified role unspecified role neutral component neutral component g17_18t mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain 10 unspecified role unspecified role neutral component neutral component physical association physical association 1D To test whether the defect in nuclear translocation of NF-B was associated with impaired formation of NF-B-DNA complexes, nuclear extracts from CHO-IR cells were subjected to EMSA to detect NF-B complexes bound to a consensus B probe. ikbkb-nfkbia-3 1 8 unspecified role unspecified role ancillary ancillary human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). 9 enzyme target enzyme target substrate substrate unspecified role unspecified role n-terminal gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 6 enzyme enzyme unspecified role unspecified role human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). phosphorylation phosphorylation reaction phosphorylation 5A & 5B TNFalpha (20ng/ml for 5 minutes) Manumycin A - sensitivity effected by a series of cys mutations of IKBKB (C179A < WT C662A/C716A) By using IKK immunocomplex kinase assays with GST-IB as a substrate, we found that TNF evoked increases in IKK activity measured in either anti-IKK or anti-IKK immunoprecipitates of HepG2 cells (Fig. 5A). However, pretreatment with manumycin A blocked both the constitutive and TNFstimulated responses. Phosphorylation of NFKBIA Anti-IKKgamma also immunoprecipitated kinase activity - since this protein has no intrinsic kinase activity, it was assumed to be part of the active complex ikbkb-1 1 6 putative self putative self putative self putative self region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined human-hep_g2 Homo sapiens hepatocellular carcinoma (HCC) cells (p53-wt). hep_g2 human hepatocellular carcinoma (HCC) cells (p53-wt). phosphorylation phosphorylation reaction phosphorylation true 5B TNFalpha (20ng/ml for 5 minutes) Manumycin A - sensitivity effected by a series of cys mutations (C179A < WT C662A/C716A) To determine whether the Cys-179 substitution to Ala (C179A) affected the sensitivity of IKK to manumycin A, epitopetagged human wild-type and mutant IKK proteins from transfected cells were immunoprecipitated and examined for their constitutive autophosphorylation and exogenous kinase activity in vitro (Fig. 5B). Autophosphorylation of NFKBIA ikbkb-2 3 5 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 5 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association 5C & 5D Manumycin A - inhibited by cys mutations (C662A/C716A). Effects of Manumycin A overcome by addition of dithiothreitol. Ectopic expression of murine IKK but not human IKK elicited formation of the complex in manumycin A-treated cells (data not shown and Fig. 5C). ikbkb-3 1 5 putative self putative self putative self putative self phosphorylation phosphorylation reaction phosphorylation true 5D Manumycin A - inhibited by cys mutations (C662A/C716A). Effects of Manumycin A overcome by addition of dithiothreitol. IKK autophosphorylation and kinase activity were efficiently inhibited with increasing concentrations of manumycin A (Fig. 5D Autophosphorylation of NFKBIA ikbkb-4 3 6 unspecified role unspecified role prey prey region ha tag ha tag YPYDVPDYA epitope tag YPYDVPDYA epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 6 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association 6C Manumycin A We found that manumycin A caused covalent IKK dimerization in intact cells (Fig. 6C). ikbkb-5 3 6 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined 7 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association 6C Manumycin A Despite the lack of IKK homodimer (Fig. 5C), formation of stable IKK/IKK heterodimer was also observed in cotransfection experiments with the two IKK constructs (Fig. 6C), consistent with their selective capacities to react with manumycin A. ikbkb-nfkbia-4 3 8 unspecified role unspecified role prey prey 6 unspecified role unspecified role bait bait region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined physical association physical association 7A Manumycin A - inhibited by cys mutation (C179A) Manumycin A Impairs IKK Interaction with IKK ikbkb-nfkbia-5 4 7 unspecified role unspecified role prey prey 8 unspecified role unspecified role bait bait 6 unspecified role unspecified role prey prey region flag tag flag tag FLAG-tagged FLAG DYKDDDDKV epitope tag DYKDDDDKV epitope tag FLAG FLAG-tagged undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined association association 7B TNFalpha (20ng/ml for 5 minutes) Manumycin A A constitutive association of IKK and IKK with IKK was detected, and TNF stimulation resulted in similar cosedimentation levels (Fig. 7, B and C).