IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. Cell (0092-8674) 2008 Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu 16-Oct-2008: Contacted by JYOTI. jyoti in vitro In vitro enzymatic study enzymatic study predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Accepted 2008-AUG-11 by JYOTI. 16-Oct-2008: Contacted by JYOTI. Cell (0092-8674) 2008 jyoti XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. Cell (0092-8674) 2008 Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu 16-Oct-2008: Contacted by JYOTI. jyoti in vitro In vitro x-ray diffraction x-ray crystallography X-ray X-ray x-ray diffraction predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Accepted 2008-AUG-11 by JYOTI. 16-Oct-2008: Contacted by JYOTI. Cell (0092-8674) 2008 jyoti XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. XPD helicase structures and activities: insights into the cancer and aging phenotypes from XPD mutations. Cell (0092-8674) 2008 Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu 16-Oct-2008: Contacted by JYOTI. jyoti in vitro In vitro atpase assay atpase assay predetermined predetermined participant predetermined Fan L., Fuss JO., Cheng QJ., Arvai AS., Hammel M., Roberts VA., Cooper PK., Tainer JA. Archaea - Interaction dataset based on Archaea proteins ATPase assay performed in the presence of single stranded DNA jat@scripps.edu Accepted 2008-AUG-11 by JYOTI. 16-Oct-2008: Contacted by JYOTI. Cell (0092-8674) 2008 jyoti atp ATP Adenosine 5'-triphosphate Adenosine triphosphate ADENOSINE-5'-TRIPHOSPHATE Adephos Adetol Adynol Atipi ATP Atriphos Cardenosine Fosfobion Glucobasin H4atp Myotriphos Triadenyl Triphosphaden adenosine 5'-(tetrahydrogen triphosphate) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) 50mer_dna 50mer DNA dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) GCTCGAGTCTAGACTGCAGTTGAGAGCTTGCTAGGACGGATCCCTCGAGG EB2F98151EC9B3FB tetra-mu3-sulfido-tetrairon tetra-mu(3)-sulfido-tetrairon (IRON/SULFUR CLUSTER) small molecule small molecule chemical synthesis Chemical synthesis (Chemical synthesis) xpd_sulac ATP-dependent DNA helicase Saci_0192 Saci_0192 protein protein sulac Sulfolobus acidocaldarius (strain ATCC 33909 / DSM 639 / JCM 8929 / NBRC 15157 / NCIMB 11770) MLKLRDWQEKLKDKVIEGLRNNFLVALNAPTGSGKTLFSLLVSLEVKPKVLFVVRTHNEFYPIYRDLTKIREKRNITFSFLVGKPSSCLYAEKGAESEDIPCKYCELKGSIVEVKTDDSPLSLVKKLKKDGLQDKFCPYYSLLNSLYKADVIALTYPYFFIDRYREFIDIDLREYMIVIDEAHNLDKVNELEERSLSEITIQMAIKQSKSEESRRILSKLLNQLREVVLPDEKYIKVENVPKLSKEELEILADDYEDIRKDSLKQGKVNKIHIGSILRFFSLLSIGSFIPFSYSKRLVIKNPEISYYLNLLNDNELSIILMSGTLPPREYMEKVWGIKRNMLYLDVEREIQKRVSGSYECYIGVDVTSKYDMRSDNMWKRYADYLLKIYFQAKANVLVVFPSYEIMDRVMSRISLPKYVESEDSSVEDLYSAISANNKVLIGSVGKGKLAEGIELRNNDRSLISDVVIVGIPYPPPDDYLKILAQRVSLKMNRENEEFLFKIPALVTIKQAIGRAIRDVNDKCNVWLLDKRFESLYWKKNLKCLNANKMKL BEE17759C4E065DA 25mer_dna 25mer DNA dna deoxyribonucleic acid DNA deoxyribonucleic acid dna DNA deoxyribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) CCTCGAGGGATCCGTCCTAGCAAGC FBFD3E7533BD3F77 xpd-atp-1 3 4 enzyme target enzyme target substrate substrate neutral component neutral component 7 enzyme enzyme neutral component neutral component Q4JC68:p.Gly34Arg mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain G R Wed May 02 15:13:06 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly34arg' Tue Jun 30 19:14:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly34Arg' Q4JC68:p.Arg514Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain R W Wed May 02 19:41:25 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg514trp' Tue Jun 30 18:09:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg514Trp' Q4JC68:p.Asp180Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain D N Wed May 02 18:25:40 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp180asn' Tue Jun 30 18:08:10 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp180Asn' Q4JC68:p.Gly447Asp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain G D Wed May 02 17:06:55 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly447asp' Tue Jun 30 16:54:21 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly447Asp' Q4JC68:p.Arg531Trp mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain R W Wed May 02 19:44:41 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg531trp' Tue Jun 30 15:44:01 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg531Trp' Q4JC68:p.Cys102Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C S Wed May 02 18:19:39 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys102ser' Tue Jun 30 16:14:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys102Ser' Q4JC68:p.Thr56Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain T A Wed May 02 16:39:35 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr56ala' Tue Jun 30 17:02:50 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr56Ala' Q4JC68:p.Tyr403Cys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain Y C Wed May 02 17:37:52 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr403cys' Tue Jun 30 20:25:38 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr403Cys' Q4JC68:p.Cys88Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C S Wed May 02 20:21:08 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys88ser' Tue Jun 30 15:58:18 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys88Ser' Q4JC68:p.Lys446Leu mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K L Wed May 02 19:13:49 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys446leu' Tue Jun 30 19:51:26 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys446Leu' Q4JC68:p.Cys523Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C R Wed May 02 19:14:58 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys523arg' Tue Jun 30 16:52:19 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys523Arg' Q4JC68:p.Lys84His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K H Wed May 02 19:53:41 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys84his' Tue Jun 30 17:51:20 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys84His' Q4JC68:p.Lys438Pro mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K P Wed May 02 20:00:38 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys438pro' Tue Jun 30 19:10:54 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys438Pro' Q4JC68:p.Asp521Gly mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain D G Wed May 02 18:35:33 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp521gly' Tue Jun 30 19:33:33 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp521Gly' ecoli Escherichia coli (strain K12) atpase reaction atpase reaction Wild-type SaXPD had an ATP-hydrolysis rate of 0.55 mol ATP per second per mol XPD with ssDNA. ATP-hydrolysis rate = 0.55 mol ATP per second per mol Sulfolobus acidocaldarius XPD with single-stranded DNA. Fig. 4 Table 2 xpd-atp-2 1 8 enzyme target enzyme target substrate substrate neutral component neutral component 5 enzyme target enzyme target substrate substrate neutral component neutral component 7 enzyme enzyme neutral component neutral component Q4JC68:p.Gly34Arg mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain G R Wed May 02 16:36:48 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly34arg' Tue Jun 30 18:45:12 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly34Arg' Q4JC68:p.Arg514Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain R W Wed May 02 16:25:36 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg514trp' Tue Jun 30 16:20:20 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg514Trp' Q4JC68:p.Asp180Asn mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain D N Wed May 02 18:59:24 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp180asn' Tue Jun 30 20:13:07 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp180Asn' Q4JC68:p.Gly447Asp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain G D Wed May 02 19:35:01 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'gly447asp' Tue Jun 30 15:51:18 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Gly447Asp' Q4JC68:p.Arg531Trp mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain R W Wed May 02 18:58:19 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg531trp' Tue Jun 30 17:13:46 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg531Trp' Q4JC68:p.Cys102Ser mutation disrupting mutation disrupting interaction mutation disrupting mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C S Wed May 02 19:07:56 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys102ser' Tue Jun 30 17:49:58 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys102Ser' Q4JC68:p.Thr56Ala mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain T A Wed May 02 18:06:24 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'thr56ala' Tue Jun 30 19:03:32 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Thr56Ala' Q4JC68:p.Tyr403Cys mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain Y C Wed May 02 20:04:35 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'tyr403cys' Tue Jun 30 20:16:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Tyr403Cys' Q4JC68:p.Cys88Ser mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C S Wed May 02 19:40:16 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys88ser' Tue Jun 30 17:31:58 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys88Ser' Q4JC68:p.Lys369Gln mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K Q Wed May 02 20:08:30 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys369gln' Tue Jun 30 18:49:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys369Gln' Q4JC68:p.Lys446Leu mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K L Wed May 02 18:37:43 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys446leu' Tue Jun 30 17:40:39 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys446Leu' Q4JC68:p.Cys523Arg mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain C R Wed May 02 19:36:20 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'cys523arg' Tue Jun 30 20:19:27 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Cys523Arg' Q4JC68:p.Lys84His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain K H Wed May 02 15:33:54 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'lys84his' Tue Jun 30 15:43:39 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Lys84His' Q4JC68:p.Asp521Gly mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain D G Wed May 02 18:34:35 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'asp521gly' Tue Jun 30 17:22:10 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Asp521Gly' ecoli Escherichia coli (strain K12) dna elongation dna strand elongation DNA replication elongation dna elongation Helicase assays were performed on a 5′-overhang substrate and yielded a wild-type rate of 2.22 base pairs per min per XPD molecule. Helicase assay rate = 2.22 base pairs per minute per molecule Sulfolobus acidocaldarius XPD. Fig. 4 Table 2, Supp. Fig. 6 By an oxidising agent - ferricyanide xpd-4fe-4s 2 6 unspecified role unspecified role neutral component neutral component 7 unspecified role unspecified role neutral component neutral component direct interaction direct interaction we therefore crystallized SaXPD and solved crystal structures with and without the bound 4Fe-4S cluster. Fig. 1, Table 1 2.0A working 22.2%, free 26.0%