IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro nmr nuclear magnetic resonance NMR NMR nmr predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions ecoli Escherichia coli (strain K12) solution sedimentati cosedimentation in solution solution sedimentati predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro crosslink cross-linking study crosslink weight by comassie molecular weight estimation by coomasie staining weight by comassie Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions mouse-oocyte Mus musculus oocyte Oocyte molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column western blot western blot Immuno blot Immuno blot Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Gamma-irradiation (Gy) Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro pull down pull down western blot western blot Immuno blot Immuno blot Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions ecoli Escherichia coli (strain K12) light scattering light scattering predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro fps fluorescence polarization spectroscopy Fluorescence anisotropy FPS FPS Fluorescence anisotropy fps predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions ecoli Escherichia coli (strain K12) ms of complexes mass spectrometry studies of complexes ms of complexes ms participant Identification by mass spectrometry ms participant Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions ecoli Escherichia coli (strain K12) molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT Cell (0092-8674) 2011 Only protein-protein interactions imex curation DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. DNA Damage in Oocytes Induces a Switch of the Quality Control Factor TAp63α from Dimer to Tetramer. Cell (0092-8674) 2011 imex curation Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de 21-Dec-2011: Contacted by JYOTI. Only protein-protein interactions in vitro In vitro molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Deutsch GB., Zielonka EM., Coutandin D., Weber TA., Schafer B., Hannewald J., Luh LM., Durst FG., Ibrahim M., Hoffmann J., Niesen FH., Senturk A., Kunkel H., Brutschy B., Schleiff E., Knapp S., Acker-Palmer A., Grez M., McKeon F., Dotsch V. Apoptosis - Interactions involving proteins with a function related to apoptosis Residue numbering differs from the given sequence in UniProt for both mouse and human isoform alpha sequences, all mutants have been remapped accordingly. email sent on Friday 7/9/11 as editor losing remarks added. ("cannot send back for curation") vdoetsch@em.uni-frankfurt.de Accepted 2011-OCT-19 by MGT 21-Dec-2011: Contacted by JYOTI. Cell (0092-8674) 2011 Only protein-protein interactions imex curation p63_mouse Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE 8DFF0284F247C68A cctattctagacatgtgaggacatgtcgatacttattcc SELEX-genreated oligonucleotide ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) CCTATTCTAGACATGTGAGGACATGTCGATACTTATTCC p63_human Tumor protein 63 TP63 KET P63 P73H P73L TP73L Transformation-related protein 63 Tumor protein p73-like p51 p40 Keratinocyte transcription factor KET Chronic ulcerative stomatitis protein protein protein human Homo sapiens Human MNFETSRCATLQYCPDPYIQRFVETPAHFSWKESYYRSTMSQSTQTNEFLSPEVFQHIWDFLEQPICSVQPIDLNFVDEPSEDGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSTKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSIQSPSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTIPDGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHEFSSPSHLLRTPSSASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDARRNKQQRIKEEGE DIP protein Q9H3D4 original sequence version: 99 DIP protein Q9H3D4 original sequence version: 100 DIP protein Q9H3D4 original sequence version: 119 DIP protein Q9H3D4-1 original sequence version: 146 DIP protein Q9H3D4 original sequence version: 146 DIP protein Q9H3D4 original sequence version: 142 DIP protein Q9H3D4 original sequence version: 68 F66ECD45E87D9799 o88898-2 Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like DeltaN-alpha protein protein mouse Mus musculus Mouse MLYLENNAQTQFSEPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE Produced by alternative promoter usage. 622E24085B8BDCB7 p21_promoter_human_dna DNA region from Human p21 promotor region ss dna single stranded deoxyribonucleic acid ss DNA ss dna chemical synthesis Chemical synthesis (Chemical synthesis) GGCAGGAACATGTCCCAACATGTTGAGCCG o88898-5 Tumor protein 63 Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like TA*-gamma TA*p63gamma protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDAFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKHLLSACFRNELVEPRGEAPTQSDVFFRHSNPPNHSVYP Produced by alternative splicing of isoform 1. A90ED0C110C50EAD o88898-1 Tumor protein 63 TA*-alpha TA*p63alpha Tp63 P63 P73l Tp73l Trp63 Transformation-related protein 63 Tumor protein p73-like protein protein mouse Mus musculus Mouse MNFETSRCATLQYCPDPYIQRFIETPAHFSWKESYYRSAMSQSTQTSEFLSPEVFQHIWDFLEQPICSVQPIELNFVDEPSENGATNKIEISMDCIRMQDSDLSDPMWPQYTNLGLLNSMDQQIQNGSSSTSPYNTDHAQNSVTAPSPYAQPSSTFDALSPSPAIPSNTDYPGPHSFDVSFQQSSTAKSATWTYSTELKKLYCQIAKTCPIQIKVMTPPPQGAVIRAMPVYKKAEHVTEVVKRCPNHELSREFNEGQIAPPSHLIRVEGNSHAQYVEDPITGRQSVLVPYEPPQVGTEFTTVLYNFMCNSSCVGGMNRRPILIIVTLETRDGQVLGRRCFEARICACPGRDRKADEDSIRKQQVSDSAKNGDGTKRPFRQNTHGIQMTSIKKRRSPDDELLYLPVRGRETYEMLLKIKESLELMQYLPQHTIETYRQQQQQQHQHLLQKQTSMQSQSSYGNSSPPLNKMNSMNKLPSVSQLINPQQRNALTPTTMPEGMGANIPMMGTHMPMAGDMNGLSPTQALPPPLSMPSTSHCTPPPPYPTDCSIVSFLARLGCSSCLDYFTTQGLTTIYQIEHYSMDDLASLKIPEQFRHAIWKGILDHRQLHDFSSPPHLLRTPSGASTVSVGSSETRGERVIDAVRFTLRQTISFPPRDEWNDFNFDMDSRRNKQQRIKEEGE Produced by alternative promoter usage. 8DFF0284F247C68A p63 9 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1B, S2A p63-1 6 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:15:56 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 10:53:56 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 16:36:08 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 20:11:42 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1F tp63 6 16 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range direct interaction direct interaction Fig. 1G tp63-tp63 9 16 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range direct interaction direct interaction Fig. 1B, S2A tp63-2 9 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1B, S2A tp63-1 9 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:17:05 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 10:59:02 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 17:28:30 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 18:34:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1B, S2A tp63-1 6 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1E tp63-1 6 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Fig. 1D p63-1 6 17 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:18:17 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 10:57:00 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 19:14:39 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 16:03:41 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 1F tp63-1 3 16 unspecified role unspecified role neutral component neutral component c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1D tp63-1 3 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1A tp63-20 3 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1B tp63-tp63-1 3 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1A tp63-2 3 17 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:17:16 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 11:09:08 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 16:07:47 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 18:05:05 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:17:17 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 11:07:43 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 15:06:07 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 19:10:36 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1C tp63-2 3 16 unspecified role unspecified role neutral component neutral component c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 16 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1D tp63-2 8 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined direct interaction direct interaction Supp. Fig. 1E A small peak indicating tetrameric protein was also observed. tp63-tp63-2 3 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 1B tp63-3 2 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range direct interaction direct interaction Supp. Figs. 1F, 1G, Table 1 A small peak indicating tetrameric protein was also observed. tp63-3 2 16 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range c_terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range direct interaction direct interaction Supp. Figs. 1F, 1H, Table 1 tp63-3 2 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:06:49 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 11:06:17 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 15:09:51 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 20:18:00 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' direct interaction direct interaction Supp. Figs. 1F, 1G, Table 1 tp63-3 4 11 unspecified role unspecified role neutral component neutral component direct interaction direct interaction Figs 2A 0 tp63-3 4 11 unspecified role unspecified role neutral component neutral component direct interaction direct interaction Figs 2A, 2D, 2E, 3d 0.52 lambda-phosphatase-treated TAp63alpha obtained from irradiated oocytes showed a high percentage of tetramers and only a relatively small increase in the dimer concentration compared with phosphorylated TAp63alpha p21-tp63 7 15 unspecified role unspecified role neutral component neutral component 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 3a p21-tp63-1 7 15 unspecified role unspecified role neutral component neutral component 17 unspecified role unspecified role neutral component neutral component O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:16:59 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 10:57:08 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 19:31:28 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 19:39:27 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 3B p21-tp63-2 7 15 unspecified role unspecified role neutral component neutral component 16 unspecified role unspecified role neutral component neutral component n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range n_terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 3C cctattctagacatg-tp63 7 16 unspecified role unspecified role neutral component neutral component c-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range n_terminus mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range ecoli Escherichia coli (strain K12) 12 unspecified role unspecified role neutral component neutral component direct interaction direct interaction Supp. Fig. 3A cctattctagaca-tp63-1 7 12 unspecified role unspecified role neutral component neutral component 17 unspecified role unspecified role neutral component neutral component n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined O88898-1:p.Arg318His mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain R H Wed May 02 19:34:37 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'arg318his' Tue Jun 30 20:16:48 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Arg318His' ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 3a cctattctagaca-tp63-2 7 12 unspecified role unspecified role neutral component neutral component 17 unspecified role unspecified role neutral component neutral component region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:18:16 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 11:04:14 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 15:28:57 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 18:36:59 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' ecoli Escherichia coli (strain K12) direct interaction direct interaction Supp. Fig. 3A tp63-3 10 17 unspecified role unspecified role neutral component neutral component n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes direct interaction direct interaction Fig. 4A, 4E, 6G, 6H Supp. Fig. 5A Mutants met413gln/ile417arg cause the protein to become a dimer. The phe55ala/trp23ala/leu62ala (FWL) mutation results in the formation of tetramers. TAp63aFWL behaves similar to DeltaNp63α, which lacks the N-terminal part of the TA domain. tp63-3 10 17 unspecified role unspecified role neutral component neutral component n-terminal myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range O88898-1:p.Phe644_Leu646delinsAlaAlaAla mutation mutation certain certain sequence position certain certain certain sequence position certain FTL AAA Thu Jul 07 12:18:38 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was phe644_thr645_leu646ala Fri Jul 22 11:06:06 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'phe644ala,thr645ala,leu646ala' Wed May 02 17:29:42 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe_thr_leu644-646ala_ala_ala' Tue Jun 30 19:39:17 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.Phe644_Leu646delinsAlaAlaAla' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes direct interaction direct interaction Fig. 4C, 4G Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-tp63-3 5 17 unspecified role unspecified role prey prey n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined O88898-1:p.[Met413Gln;Ile417Arg] mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain M Q certain certain sequence position certain certain certain sequence position certain I R Wed May 02 17:30:23 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'met413gln,ile417arg' Tue Jun 30 18:45:33 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Met413Gln;Ile417Arg]' rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes 17 unspecified role unspecified role bait bait transactivation inhibition region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 5F Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-tp63-5 5 16 unspecified role unspecified role prey prey c_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes 17 unspecified role unspecified role bait bait transactivation inhibition region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined ecoli Escherichia coli (strain K12) direct interaction direct interaction Fig. 5F Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-tp63-6 5 17 unspecified role unspecified role bait bait region gst tag glutathione s tranferase tag glutathione S-tranferase tag glutathione S-tranferase tag gst tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined transactivation activation region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 17 unspecified role unspecified role prey prey O88898-1:p.[Phe55Ala;Trp59Ala;Leu62Ala] mutation increasing mutation increasing interaction mutation increasing certain certain sequence position certain certain certain sequence position certain F A certain certain sequence position certain certain certain sequence position certain W A certain certain sequence position certain certain certain sequence position certain L A Wed May 02 19:33:55 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe55ala,trp59ala,leu62ala' Tue Jun 30 19:50:07 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Phe55Ala;Trp59Ala;Leu62Ala]' O88898-1:p.[Met413Gln;Ile417Arg] mutation increasing mutation increasing interaction mutation increasing mutation analysis mutation analysis certain certain sequence position certain certain certain sequence position certain M Q certain certain sequence position certain certain certain sequence position certain I R Wed May 02 18:31:26 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'met413gln,ile417arg' Tue Jun 30 20:09:37 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Met413Gln;Ile417Arg]' n_terminus myc tag myc tag EUKLISEED epitope tag EUKLISEED epitope tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range rabit-reticulocyte Oryctolagus cuniculus reticulocyte reticulocyte Reticulocytes direct interaction direct interaction Fig. 5H, 5I, 6I, 6J Deletion of a helical domain within the oligermerisation domain prevents tetramer formation but not dimerization. tp63-7 9 14 unspecified role unspecified role neutral component neutral component region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain n-terminal his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range n-terminal mbp tag maltose binding protein tag maltose binding protein tag maltose binding protein tag mbp tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range direct interaction direct interaction Fig. 6A tp63-tp63-7 1 13 unspecified role unspecified role neutral component neutral component Q9H3D4:p.[Phe55Ala;Trp59Ala;Leu62Ala] mutation decreasing mutation decreasing interaction hotspot hotspot mutation decreasing certain certain sequence position certain certain certain sequence position certain W A certain certain sequence position certain certain certain sequence position certain F A certain certain sequence position certain certain certain sequence position certain L A Fri Jul 22 11:02:55 BST 2016 This feature has been corrected as a result of our quality control procedures. The original label was 'trp59ala,phe55ala,leu62ala' Wed May 02 19:21:54 BST 2018 This feature has been corrected as a result of our quality control procedures. The original label was 'phe55ala,trp59ala,leu62ala' Tue Jun 30 18:09:09 BST 2020 This feature has been corrected as a result of our quality control procedures. The original label was 'p.[Phe55Ala;Trp59Ala;Leu62Ala]' region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain chemical synthesis Chemical synthesis (Chemical synthesis) 13 unspecified role unspecified role neutral component neutral component region 15n label 15n label 15N N15 15N N15 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain ecoli Escherichia coli (strain K12) 183 186 direct interaction direct interaction Fig. 6B-D