IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ hassan-2021-1 in vitro In vitro ir spectrometry infrared spectroscopy ir spectrometry predetermined predetermined participant predetermined Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN., Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN. Virus - Publications including interactions involving viral proteins This publication is stated to be about NSP14 - yet they give the residue numbers for NSP16 in the Supplementary Methods: Genbank accession QOQ05163.1 from section 6799 to 7096. These amino acids correspond to NSP16. However in figure S1 the molecular weight of the protein shown is consistent with NSP14 rather than NSP16. The authors did not respond to a request for information/clarification. frankcrespilho@iqsc.usp.br Chembiochem : a European journal of chemical biology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus hassan-2021-2 in vitro In vitro uv-vis ultraviolet-visible spectroscopy uv-vis predetermined predetermined participant predetermined Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN., Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN. Virus - Publications including interactions involving viral proteins This publication is stated to be about NSP14 - yet they give the residue numbers for NSP16 in the Supplementary Methods: Genbank accession QOQ05163.1 from section 6799 to 7096. These amino acids correspond to NSP16. However in figure S1 the molecular weight of the protein shown is consistent with NSP14 rather than NSP16. The authors did not respond to a request for information/clarification. frankcrespilho@iqsc.usp.br Chembiochem : a European journal of chemical biology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus hassan-2021-3 ecoli Escherichia coli (strain K12) ion exchange chrom ion exchange chromatography IEC IEC ion exchange chrom weight by staining molecular weight estimation by staining weight by staining Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN., Hassan A., Sedenho GC., Vitale PAM., Oliveira MN., Crespilho FN. Virus - Publications including interactions involving viral proteins This publication is stated to be about NSP14 - yet they give the residue numbers for NSP16 in the Supplementary Methods: Genbank accession QOQ05163.1 from section 6799 to 7096. These amino acids correspond to NSP16. However in figure S1 the molecular weight of the protein shown is consistent with NSP14 rather than NSP16. The authors did not respond to a request for information/clarification. frankcrespilho@iqsc.usp.br Chembiochem : a European journal of chemical biology 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ssrna substrate rna ribonucleic acid RNA rna chemical synthesis Chemical synthesis (Chemical synthesis) AACAUCACUAACAUACAGUGACCAA This RNA sequence gives a match (for residues 2-20) to several Carassius auratus (Goldfish) predicted sequences e.g. XM_026234235.1 This RNA sequence gives a match (for residues 2-20) to several Carassius auratus predicted sequences e.g. XM_026234235.1 p0dtd1-pro_0000449631 Proofreading exoribonuclease nsp14 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AENVTGLFKDCSKVITGLHPTQAPTHLSVDTKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATREAVGTNLPLQLGFSTGVNLVAVPTGYVDTPNNTDFSRVSAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKNLSDRVVFVLWAHGFELTSMKYFVKIGPERTCCLCDRRATCFSTASDTYACWHHSIGFDYVYNPFMIDVQQWGFTGNLQSNHDLYCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWTIEYPIIGDELKINAACRKVQHMVVKAALLADKFPVLHDIGNPKAIKCVPQADVEWKFYDAQPCSDKAYKIEELFYSYATHSDKFTDGVCLFWNCNVDRYPANSIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFVNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRLYLDAYNMMISAGFSLWVYKQFDTYNLWNTFTRLQ 5926 6452 rep-ssrna substrate-1 4087114 N/A 4087117 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4087118 unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus sumo tag sumo tag SUMO tag sumo tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1 B/D rep-ssrna substrate-2 4087115 N/A 4087117 unspecified role unspecified role neutral component neutral component chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4087118 unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus sumo tag sumo tag SUMO tag sumo tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 2 rep-278 4087116 N/A 4087118 weight by staining molecular weight estimation by staining weight by staining anti tag western anti tag western blot anti tag western unspecified role unspecified role neutral component neutral component purified purified region his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus sumo tag sumo tag SUMO tag sumo tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) Stoichiometry: 2.0 direct interaction direct interaction false false false Supp. figure 1