IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ saramago-2021-1 in vitro In vitro ribonuclease assay ribonuclease assay weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Saramago M., Bárria C., Costa VG., Souza CS., Viegas SC., Domingues S., Lousa D., Soares CM., Arraiano CM., Matos RG. Virus - Publications including interactions involving viral proteins margaridasaramago@itqb.unl.pt, cecilia@itqb.unl.pt, rmatos@itqb.unl.pt The FEBS journal 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus saramago-2021-2 in vitro In vitro spr surface plasmon resonance Optical biosensor BIAcore(r) BIAcore(r) Optical biosensor spr predetermined predetermined participant predetermined Saramago M., Bárria C., Costa VG., Souza CS., Viegas SC., Domingues S., Lousa D., Soares CM., Arraiano CM., Matos RG. Virus - Publications including interactions involving viral proteins margaridasaramago@itqb.unl.pt, cecilia@itqb.unl.pt, rmatos@itqb.unl.pt The FEBS journal 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus saramago-2021-3 ecoli Escherichia coli (strain K12) molecular sieving molecular sieving Gel Filtration Size Exclusion Chromatography Size Exclusion Chromatography Gel Filtration Sizing column predetermined predetermined participant predetermined Saramago M., Bárria C., Costa VG., Souza CS., Viegas SC., Domingues S., Lousa D., Soares CM., Arraiano CM., Matos RG. Virus - Publications including interactions involving viral proteins margaridasaramago@itqb.unl.pt, cecilia@itqb.unl.pt, rmatos@itqb.unl.pt The FEBS journal 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus saramago-2021-4 in vitro In vitro methyltransferase as methyltransferase assay methyltransferase as weight autoradiogra molecular weight estimation by autoradiography weight autoradiogra Saramago M., Bárria C., Costa VG., Souza CS., Viegas SC., Domingues S., Lousa D., Soares CM., Arraiano CM., Matos RG. Virus - Publications including interactions involving viral proteins Interactions (the conversion of G*pppRNA to m7G*pppRNA) were detected by relative movement of radioactive species via TLC. margaridasaramago@itqb.unl.pt, cecilia@itqb.unl.pt, rmatos@itqb.unl.pt The FEBS journal 2021 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ds_h4_rna ds rna ds rna double stranded ribonucleic acid chemical synthesis Chemical synthesis (Chemical synthesis) UGACGGCCCGGAAAACCGGGCC p0dtd1-pro_0000449628 Non-structural protein 10 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AGNATEVPANSTVLSFCAFAVDAAKAYKDYLASGGQPITNCVKMLCTHTGTGQAITVTPEANMDQESFGGASCCLYCRCHIDHPNPKGFCDLKGKYVQIPTTCANDPVGFTLKNTVCTVCGMWKGYGCSCDQLREPMLQ 4254 4392 p0dtd1-pro_0000449631 Proofreading exoribonuclease nsp14 rep ORF1ab polyprotein 1a-1b protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV AENVTGLFKDCSKVITGLHPTQAPTHLSVDTKFKTEGLCVDIPGIPKDMTYRRLISMMGFKMNYQVNGYPNMFITREEAIRHVRAWIGFDVEGCHATREAVGTNLPLQLGFSTGVNLVAVPTGYVDTPNNTDFSRVSAKPPPGDQFKHLIPLMYKGLPWNVVRIKIVQMLSDTLKNLSDRVVFVLWAHGFELTSMKYFVKIGPERTCCLCDRRATCFSTASDTYACWHHSIGFDYVYNPFMIDVQQWGFTGNLQSNHDLYCQVHGNAHVASCDAIMTRCLAVHECFVKRVDWTIEYPIIGDELKINAACRKVQHMVVKAALLADKFPVLHDIGNPKAIKCVPQADVEWKFYDAQPCSDKAYKIEELFYSYATHSDKFTDGVCLFWNCNVDRYPANSIVCRFDTRVLSNLNLPGCDGGSLYVNKHAFHTPAFDKSAFVNLKQLPFFYYSDSPCESHGKQVVSDIDYVPLKSATCITRCNLGGAVCRHHANEYRLYLDAYNMMISAGFSLWVYKQFDTYNLWNTFTRLQ 5926 6452 30mer_gppp-rna rna ribonucleic acid RNA rna in vitro In vitro GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN ds_h4_rna-rep-2 4044661 N/A 4044665 enzyme target enzyme target substrate substrate neutral component neutral component 5' 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4044666 stimulator stimulator neutral component neutral component purified purified P0DTD1-PRO_0000449628:p.His80Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Phe19Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Gly69Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Tyr96Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTD1-PRO_0000449628:p.Ser72Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 4044667 enzyme enzyme neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) rna cleavage rna cleavage false false false 1C, 1E, 2, 4D, 5C Co-purifying nsp14 and nsp10 proteins substantially increases nsp14 ExoNase activity. MnCl2 Mgcl2 Addition of ZnCl2 and CoCl2 caused a slight increase in ExoN activity. EDTA (CHEBI:42191 ) Mutations of nsp10 (with the exception of S72A) reduced ExoNase activity to that of nsp14 alone. The S72A mutation further decreased activity. ds_h4_rna-rep-1 4044661 N/A 4044665 enzyme target enzyme target substrate substrate neutral component neutral component 5' 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4044667 enzyme enzyme neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) rna cleavage rna cleavage false false false 1C, 1E, 4D, 5C nsp14 alone exhibits exoribonucleolytic activity; however low activity was seen. ds_h4_rna-rep-3 4044661 N/A 4044665 enzyme target enzyme target substrate substrate neutral component neutral component 5' 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false chemical synthesis Chemical synthesis (Chemical synthesis) N/A 4044666 stimulator stimulator neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 4044667 enzyme enzyme neutral component neutral component purified purified P0DTD1-PRO_0000449631:p.Asp90Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTD1-PRO_0000449631:p.Glu92Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Asp243Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Asp273Ala mutation decreasing rate mutation decreasing interaction rate mutation decreasing rate certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) rna cleavage rna cleavage false false false 5C Co-purifying nsp14 and nsp10 proteins substantially increases nsp14 ExoNase activity. MnCl2 Mgcl2 Addition of ZnCl2 and CoCl2 caused a slight increase in ExoN activity. EDTA (CHEBI:42191 ) Mutations of nsp10 (with the exception of S72A) reduced ExoNase activity to that of nsp14 alone. The S72A mutation further decreased activity. rep-rep-147 4044662 N/A 4044666 unspecified role unspecified role prey prey purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTD1-PRO_0000449628:p.Phe19Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Ser72Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Gly69Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.His80Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449628:p.Tyr96Ala mutation disrupting strength mutation disrupting interaction strength mutation disrupting strength certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 4044667 unspecified role unspecified role bait bait purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1D, 4C As both proteins are unstable, it was not possible to obtain a good fit of the data in order to determine the binding kinetics and dissociation constants. rep-rep-148 4044663 N/A 4044666 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false N/A 4044667 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false direct interaction direct interaction false false false 1E When co-purified, there are several peaks that can not be seen when the proteins are purified alone. rep-rep-149 4044664 N/A 4044667 enzyme enzyme neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTD1-PRO_0000449631:p.Asp90Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Glu92Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Asp243Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Asp273Ala mutation with no effect mutation with no effect mutation with no effect mutation not affecting interaction certain certain sequence position certain certain certain sequence position certain false P0DTD1-PRO_0000449631:p.Asp331Ala mutation disrupting rate mutation disrupting interaction rate mutation disrupting rate certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 4044668 enzyme target enzyme target substrate substrate neutral component neutral component guanosine 32p radiolabel 32p radiolabel P32 32P 32P P32 certain certain sequence position certain certain certain sequence position certain false in vitro In vitro methylation methylation reaction methylation false false false 6 nsp14 MTase activity seems to be independent of the presence of nsp10 cofactor.