IntAct European Bioinformatics Institute IntAct intact http://www.ebi.ac.uk/ http://www.ebi.ac.uk/intact/query/${ac} EBI-[0-9]+|IA:[0-9]+ INTerAction database (IntAct) provides an open source database and toolkit for the storage, presentation and analysis of molecular interactions. http://www.ebi.ac.uk/intact European Bioinformatics Institute; Wellcome Trust Genome Campus; Hinxton, Cambridge; CB10 1SD; United Kingdom http://www.ebi.ac.uk/intact/ http://www.ebi.ac.uk/ iserman-2020-1 in vitro In vitro fluorescence imaging fluorescence microscopy fluorescence imaging predetermined predetermined participant predetermined Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Molecular cell 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus iserman-2020-2 in vitro In vitro frap fluorescence recovery after photobleaching frap predetermined predetermined participant predetermined Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Molecular cell 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus iserman-2020-3 in vitro In vitro crosslink cross-linking study crosslink nucleotide sequence nucleotide sequence identification sequence cloning sequence cloning nucleotide sequence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins RNP-MaP: lysine residues are selectively crosslinked to proximal RNA nucleotides ;see PMID: 33077962. Crosslinker - S.D.A. (NHS-diazirine) rapidly labels RNA nucleotides at sites of protein binding on exposure to UV light. Crosslinked proteins were digested to short peptide adducts and after RNA isolation, followed by treatment with a MaP -a reverse transcriptase that incorporates non-templated nucleotides into the product DNA at the site of RNA–protein crosslinks. DNA sequencing follows. amyglad@unc.edu Molecular cell 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus iserman-2020-4 human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. fluorescence imaging fluorescence microscopy fluorescence imaging tag fluorescence tag visualisation by fluorescence tag fluorescence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Molecular cell 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus iserman-2020-5 human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. frap fluorescence recovery after photobleaching frap tag fluorescence tag visualisation by fluorescence tag fluorescence Iserman C., Roden CA., Boerneke MA., Sealfon RSG., McLaughlin GA., Jungreis I., Fritch EJ., Hou YJ., Ekena J., Weidmann CA., Theesfeld CL., Kellis M., Troyanskaya OG., Baric RS., Sheahan TP., Weeks KM., Gladfelter AS. Virus - Publications including interactions involving viral proteins amyglad@unc.edu Molecular cell 2020 Only protein-protein interactions imex curation imex curation Coronavirus - Interactions investigated in the context of Coronavirus ncap_sars2 Nucleoprotein N Nucleocapsid protein protein protein SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV MSDNGPQNQRNAPRITFGGPSDSTGSNQNGERSGARSKQRRPQGLPNNTASWFTALTQHGKEDLKFPRGQGVPINTNSSPDDQIGYYRRATRRIRGGDGKMKDLSPRWYFYYLGTGPEAGLPYGANKDGIIWVATEGALNTPKDHIGTRNPANNAAIVLQLPQGTTLPKGFYAEGSRGGSQASSRSSSRSRNSSRNSTPGSSRGTSPARMAGNGGDAALALLLLDRLNQLESKMSGKGQQQQGQTVTKKSAAEASKKPRQKRTATKAYNVTQAFGRRGPEQTQGNFGDQELIRQGTDYKHWPQIAQFAPSASAFFGMSRIGMEVTPSGTWLTYTGAIKLDDKDPNFKDQVILLNKHIDAYKTFPPTEPKKDKKKKADETQALPQRQKKQQTVTLLPAADLDDFSKQLQQSMSSADSTQA genomic_rna rna ribonucleic acid RNA rna SARS-CoV-2 SARS-CoV-2 SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2 2019-nCoV 387 additional nucleotides rna ribonucleic acid RNA rna in vitro In vitro CTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAAAGTTT 1988 additional nucleotides rna ribonucleic acid RNA rna in vitro In vitro CTAGAAGATCTCCTACAATATTCTCAGCTGCCATGGAAAATCGATGTTCTTCTTTTATTCTCTCAAGATTTTCAGGCTGTATATTAAAACTTATATTAAGAACTATGCTAACCACCTCATCAGGAACCGTTGTAGGTGGCGTGGGTTTTCTTGGCAATCGACTCTCATGAAAACTACGAGCTAAATATTCAATATGTTCCTCTTGACCAACTTTATTCTGCATTTTTTTTGAACGAGGTTTAGAGCAAGCTTCAGGAAACTGAGACAGGAATTTTATTAAAAATTTAAATTTTGAAGAAAGTTCAGGGTTAATAGCATCCATTTTTTGCTTTGCAAGTTCCTCAGCATTCTTAACAAAAGACGTCTCTTTTGACATGTTTAAAGTTTAAACCTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACATTATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCAATTGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGAT anti-sense frame shifting region rna ribonucleic acid RNA rna in vitro In vitro ACACTGTAGAGAATAAAACATTAAAGTTTGCACAATGCAGAATGCATCTGTCATCCAAACAGTTAACACAATTTGGGTGGTATGTCTGATCCCAATATTTAAAATAACGGTCAAAGAGTTTTAACCTCTCTTCCGTGAAGTCATATTTTAACAAATCCCACTTAATGTAAGGCTTTGTTAAGTCAGTGTCAACATGTGACTCTGCAGTTAAAGCCCTGGTCAAGGTTAATATAGGCATTAACAATGAATAATAAGAATCTACAACAGGAACTCCACTACCTGGCGTGGTTTGTATGAAATCACCGAAATCATACCAGTTACCATTGAGATCTTGATTATCTAATGTCAGTACACCAACAATACCAGCATTTCGCATGGCATCACAGAATTGTACTGTTTTTAACAAAGCTTGGCGTACACGTTCACCTAAGTTGGCGTATACGCGTAATATATCTGGGTTTTCTACAAAATCATACCAGTCCTTTTTATTGAAATAATCATCATCACAACAATTGTATGTGACAAGTATTTCTTTTAATGTGTCACAATTACCTTCATCAAAATGCCTTAAAGCATAGACGAGGTCTGCCATTGTGTATTTAGTAAGACGTTGACGTGATATATGTGGTACCATGTCACCGTCTATTCTAAACTTAAAGAAGTCATGTTTAGCAACAGCTGGACAATCCTTAAGTAAATTATAAATTGTTTCTTCATGTTGGTAGTTAGAGAAAGTGTGTCTCTTAACTACAAAGTAAGAATCAATTAAATTGTCATCTTCGTCCTTTTCTTGGAAGCGACAACAATTAGTTTTTAGGAATTTAGCAAAACCAGCTACTTTATCATTGTAGATGTCAAAAGCCCTGTATACGACATCAGTACTAGTGCCTGTGCCGCACGGTGTAAGACGGGCTGCACTTACACCGCAAACCCGTTTAAAAACGATTGTGCATCAGCTGACTGAAGCATSGGGTTCGCGGAGTTGATCACAACTACAGCCA grna-n-1 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium chlae-vero_e6 chlae-vero_e6 cells vero_e6 vero_e6 cell African green monkey kidney epithelial cells epithelium Epithelium [epithelial cells] direct interaction direct interaction false false false 1B genomic_rna-n-1 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 1A, LHS No His-tag on N protein. genomic_rna-n-2 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified ptms modres protein modification ModRes undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false c-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false human-293 Homo sapiens transformed primary embryonal kidney cells Human 293 Transformed human primary embryonal kidney cells. The Cell type named 293 is synonymous with HEK-293. N/A 3975489 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 1A, RHS, 1B genomic_rna-n-3 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified ptms modres protein modification ModRes undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 1B Unmodified protein (with less ptms) yielded larger, more abundant droplets. genomic_rna-n-4 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1F, Supp. figure 1E N-protein at 4 uM. RNA concentration 25nm. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range. genomic_rna-n-5 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Tyr109Ala mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Tyr109Ala mutation increasing strength mutation increasing interaction strength mutation increasing strength certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) direct interaction direct interaction false false false 1E- RHS, 2A, 5A, Supp. figure 1D, 2A, 6 On figure 1E stated to be the "control" on the image, and assumed to be in the absence of RNA. N-protein at 1-2 uM;4 uM in figure 2A, not stated for figure S2A or 6. Increased temperature:N-protein alone, demixed into droplets in a temperature-dependent manner, highly pronounced at fever temperature (40°C) and above (45°C). genomic_rna-n-6 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1E N-protein at 1 uM. RNA concentration 5nm. The 5′ end and the nucleocapsid RNAs promoted LLPS; the frameshifting region and the PS region RNAs reduced LLPS relative to N-protein alone. genomic_rna-n-7 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1F, Supp. figure 1D/E N-protein at 2-4 uM. RNA concentration 0.5-50 nm. 387 additional nucleotides-genomic_rna-2 3975483 N/A 3975490 stimulator stimulator neutral component neutral component in vitro In vitro N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1H N-protein at 2 uM. RNA concentration 5nm. Addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 387 additional nucleotides-genomic_rna-1 3975483 N/A 3975490 stimulator stimulator neutral component neutral component in vitro In vitro N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1H N-protein at 2 uM. RNA concentration 5nm. Addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 1988 additional nucleotides-genomic_rna-1 3975483 N/A 3975491 stimulator stimulator neutral component neutral component in vitro In vitro N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1H N-protein at 2 uM. RNA concentration 5nm. It is stated that the addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. 1988 additional nucleotides-genomic_rna-2 3975483 N/A 3975491 stimulator stimulator neutral component neutral component in vitro In vitro N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 1H N-protein at 2 uM. RNA concentration 5nm. It is stated that the addition of 0.3 kb or 2.4 kb of non-viral sequence to the 1 kb 5′ end or frameshifting region RNAs resulted in a progressive increase in condensate size/number. anti_sense frame shifting region-n-1 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975492 unspecified role unspecified role neutral component neutral component infection infection conditioned medium conditioned medium in vitro In vitro direct interaction direct interaction false false false 1F, Supp. figure 1E N-protein at 4 uM. RNA concentration 25nm. genomic_rna-n-8 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975492 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction false false false Supp. figure 1E genomic_rna-n-9 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 1F N-protein at 1 uM. RNA concentration 5 nm. When combined with 5′ end RNA, total lung RNA (2.75 ng/ul) synergized with the 5′ end increasing the condensate size, number, and viral RNA enrichment. genomic_rna-n-10 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 2A. Lowering of the temperature;addition of the 5′ end RNA lowered the most efficient condensation temperatures to 37°C and 33°C, from 40-45 degrees for the N protein alone. genomic_rna-n-11 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 2 A/C Lowering of the temperature;addition of the 5′ end RNA lowered the most efficient condensation temperatures to 37°C and 33°C, from 40-45 degrees for the N protein alone. This effect was independent of RNA sequence. genomic_rna-n-13 3975483 N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy5 label cy5 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro physical association physical association false false false 2E 5′ end RNA (cy5 tag) readily mixed into preformed N-protein-5′ end (cy3 tag) condensates; in contrast, subgenomic nucleocapsid RNA was excluded from the preformed 5′ end droplets. genomic_rna-n-14 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false 2G -LHS RNA concentration 50nm. N protein concentration not stated. genomic_rna-n-16 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Tyr109Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false 5A RNA at 5-50nm, N protein concentration not stated. genomic_rna-n-17 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false 6 G-J, Supp. figure 7 N-protein and RNA concentrations not stated. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range. 1,6-hexanediol (CHEBI:43078 ) lipoic acid (CHEBI:16494) kanamycin (CHEBI:6104) genomic_rna-n-12 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Supp. figure 4 genomic_rna-n-19 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false region cy3 label cy3 label undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false in vitro In vitro direct interaction direct interaction false false false Supp. figure 4 genomic_rna-n-20 3975483 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false P0DTC9:p.Tyr109Ala mutation decreasing strength mutation decreasing interaction strength mutation decreasing strength certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component frameshifting region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 6 N-protein concentration not stated;RNA 15 and 25nM. The frameshifting region promoted LLPS only within a narrow protein and RNA concentration range. genomic_rna-n-15 3975484 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified region atto 488 atto 488 undetermined undetermined sequence position undetermined undetermined undetermined sequence position undetermined false n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component 5' utr sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false 5' utr and nucleocaspid region sufficient to bind sufficient binding region sufficient to bind certain certain sequence position certain certain certain sequence position certain false certain certain sequence position certain certain certain sequence position certain false in vitro In vitro direct interaction direct interaction false false false Supp. figure 2B N-protein signal recovered faster in 5′ end RNA droplets than in nucleocapsid RNA droplets. genomic_rna-n-18 3975485 N/A 3975488 unspecified role unspecified role neutral component neutral component purified purified n-terminus his tag his tag Hexa-His-tag 6-His-tag Histidine-tag Hexa-His-tag Histidine-tag 6-His-tag n-term range n-terminal range n-term range n-term range n-terminal range n-term range false p.Tyr109Ala mutation with complex effect mutation with complex effect certain certain sequence position certain certain certain sequence position certain false ecoli Escherichia coli (strain K12) N/A 3975489 unspecified role unspecified role neutral component neutral component in vitro In vitro direct interaction direct interaction false false false Figure 3,4,5, Supp. figure 4 N-protein interacts specifically with a few preferred sites in the 5′ end in both diffuse and condensed states and interacts more homogeneously across the frameshifting region. The PS region is homogeneously coated with N-protein in both diffuse and condensed states, similar to the frameshifting region. Nucleocapsid RNA:there are few N-protein interactions. RNA 50nm, N protein 4uM for the Frameshifting region. 25-50nm RNA and 4uM for 5' end. n-n-47 3975486 N/A 3975488 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false N/A 3975488 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain false colocalization colocalization false false false 6 A-D, K Results suggest that N-protein forms cytoplasmic, liquid-like condensates in cells. Kanamycin caused relocalization of N-GFP to the cell nucleus. n-n-48 3975487 N/A 3975488 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain false C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false N/A 3975488 unspecified role unspecified role neutral component neutral component over-expressed over expressed level over-expressed C-terminus gfp tag green fluorescent protein tag GFP green fluorescent protein GFP green fluorescent protein gfp tag c-term range C-terminal range c-term range c-term range C-terminal range c-term range false P0DTC9:p.Gly335Ala mutation mutation certain certain sequence position certain certain certain sequence position certain false physical association physical association false false false 6 E/F N-protein droplets readily underwent fusion and recovered partially following FRAP.